1. Mutations
Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations in existing genes lead to changes in function and phenotype

2. Gene Mutations
Gene mutations are changes in one or more of the nucleotides in a gene.
Germ-cell mutations occur in gametes and can be passed on to offspring.
New traits, no changes, birth defects, genetic diseases
Somatic-cell mutations occur in body cells and affect only the individual organism.
No effect on cell, cell dies, cell becomes cancerous

3. Point Mutations One nucleotide changes (called a base substitution)
changes only one amino acid (if any!)
Silent mutations code for the same amino acid

4. CACGTGGACTGAGGACTCCTC Codon for CTC = glutamate CACGTGGACTGAGGACACCTC
Codon for CAC =
valine
What does it matter???
Changing one amino acid changes the shape of the protein which can change how it functions

6. Frameshift Mutation a single base is added or deleted
changes every amino acid after the mutation site
- also called a nonsense mutation because the protein is so different it can’t function

8. Chromosome Mutations
Chromosome mutations are changes in the structure of a chromosome or the loss or gain of an entire chromosome.
Inversion – a piece of the chromosome rotates
Deletion – losing part of a chromosome
Insertion – adding part of a chromosome
Translocation – a piece of chromosome changes place with a piece on another chromosome (two deletions and two insertions)

10. What can cause a mutation?
A mutation can be inherited, caused by environmental agents, or happen spontaneously Mutagen – anything environmental that can cause a change in DNA

11. Mutagens
Radiation – UV, X-rays, nuclear

12. Mutagens
Chemicals – asbestos, formaldehyde, chemicals in tobacco products
(many mutagens are also carcinogens – cancer causing)

13. Mutation Repair
Note: Our DNA mutates all the time, but our cells have repair mechanisms. It is the overexposure to a mutagen that causes the worst problems, because the cell cannot repair all of it in time. Also, repair effectiveness reduces with age.