Download presentation
Presentation is loading. Please wait.
1
Unit 7: Molecular Genetics
7.5 Mutations
2
Mutations Mutations: Changes to DNA changes the DNA changes the mRNA
may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait
3
Mutations An organisms traits are based on their DNA sequence because:
DNA sequence amino acid sequence protein shape function Trait If there are changes in the DNA sequence, it can lead to changes in traits.
4
Types of mutations Changes to the letters (A,C,T,G bases) in the DNA
point mutation: change to ONE letter (base) in the DNA (substitution) may cause change to protein, may not frameshift mutation: addition or deletion of a letter (base) in the DNA sequence. both of these shift the DNA so it changes how the codons are read
5
Point Mutations- Examples
One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN
6
Point Mutations- Examples
Sometimes the amino acid changes AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? DEPENDS… AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop
7
Misshapen sickle cells
Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids
8
Frameshift Mutations- Examples
Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN
9
Frameshift Mutations- Examples
Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA
10
Frameshift Mutations- Examples
Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA
11
Cystic fibrosis Broken salt channel in cells
strikes 1 in 2500 white births gene codes for a protein channel that allows salt to flow across cell membrane broken protein doesn’t work as channel doesn’t allow salt out of cell, so water doesn’t flow out either thicker & stickier mucus coating around cells mucus build-ups in lungs & causes bacterial infections destroys lung function without treatment children die before 5; with treatment can live past their late 20s Cystic fibrosis is an inherited disease that is relatively common in the U.S. Cystic fibrosis affects multiple parts of the body including the pancreas, the sweat glands, and the lungs. When someone has cystic fibrosis, they often have lots of lung problems. The cause of their lung problems is directly related to basic problems with diffusion and osmosis in the large airways of the lungs. People without cystic fibrosis have a small layer of salt water in the large airways of their lungs. This layer of salt water is under the mucus layer which lines the airways. The mucus layer in the airways helps to clear dust and other inhaled particles from the lungs.
12
Deletion leads to Cystic fibrosis
Loss of one amino acid!
13
Types of mutations Changes to the letters (A,C,T,G bases) in the DNA
Stop mutation: causes the protein to stop forming prematurely or causes the continual translation beyond where the stop should be.
14
Stop Mutation- Example
AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Really destroyed that protein! AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop
15
Types of mutations Changes to the letters (A,C,T,G bases) in the DNA
Chromosomal mutation: Changes in the number or structure of chromosomes Silent mutation: Mutations in the DNA that do not significantly alter the expression of genes
16
Silent mutation- Example
AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop The code has repeats in it! Does this change the protein? Why not? AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop
17
Causes of Mutations DNA fails to copy accurately
External agents cause DNA to break down Examples: Environmental toxins, radiation, smoke, etc.
18
Questions Identify the following types of mutations:
Original gene sequence: CTTAGCATGC Mutation A: CTAGCATGC Mutation B: CTTAGGCATGC Mutation C: CTTAGTATGC
Similar presentations
