1. Adenosine Diphosphate–Induced Platelet Aggregation Is Associated With P2Y12 Gene Sequence Variations in Healthy Subjects
by Pierre Fontana, Annabelle Dupont, Sophie Gandrille, Christilla Bachelot-Loza, Jean-Luc Reny, Martine Aiach, and Pascale Gaussem
Circulation
Volume 108(8):
August 26, 2003
Copyright © American Heart Association, Inc. All rights reserved.

2. Figure 1. Location of the primers and polymorphisms in the P2Y12 gene.
Figure 1. Location of the primers and polymorphisms in the P2Y12 gene. A polymerase chain reaction product of ≈3100 bp was obtained with primers E and J. This PCR product was then sequenced by using sense primers E, G, L, C, and M and antisense primers K, H, B, and J. The primer sequences are as follows: B, 5′TCATGCCAGACTAGACCGAA3′; C, 5′ATCGATCGCTACCAGAAGACCACC3′; E, 5′GGCTGCAATAACTACTACTT3′; G, 5′TAAATAGGTGAGGAGATGCTG3′; H, 5′TGCATTTCTTGTTGGTTACCT3′; J, 5′GTCGTTTGTTTTGCTGCTAATA3′; K, 5′CATTGAGAATTTCAGCTCCC3′; L, 5′ATACTAACTACTACAATGAAGAT3′; and M, 5′CCTTACACCCTGAGCCAAAC3′. ATG and TAA are start and stop codons, respectively. I-C139T, i-T744C, i-ins801A, C34T, and G52T are the polymorphisms found in the study population.
Pierre Fontana et al. Circulation. 2003;108:
Copyright © American Heart Association, Inc. All rights reserved.

3. Figure 2. Screened P2Y12 nt sequence.
Figure 2. Screened P2Y12 nt sequence. Section 1, Exon 1 and its 3′ flanking region. Nucleotide 1 is the start site of the intron. Section 2, exon 2 and its 5′ flanking region. Nucleotide 1 is the start site of exon 2. Exon sequences are capitalized.
Pierre Fontana et al. Circulation. 2003;108:
Copyright © American Heart Association, Inc. All rights reserved.

4. Figure 3. Maximal platelet aggregation responses to ADP in 98 healthy volunteers.
Figure 3. Maximal platelet aggregation responses to ADP in 98 healthy volunteers. After a 3-minute incubation period, platelets (250×109/L in citrated PRP) were stimulated with 2 μmol/L ADP. The concordance coefficient between aggregation values recorded at visit 1 and visit 2 (1 week later) was 77% (P<0.001).
Pierre Fontana et al. Circulation. 2003;108:
Copyright © American Heart Association, Inc. All rights reserved.

5. Figure 4. Maximal aggregation in response to 2 μmol/L ADP according to the P2Y12 haplotype.
Figure 4. Maximal aggregation in response to 2 μmol/L ADP according to the P2Y12 haplotype. The average of the maximal aggregation values recorded at visits 1 and 2 in each volunteer was used for analysis. The median value was 34.7% in subjects carrying no H2 alleles (H1/H1, n=74), 67.9% in subjects carrying 1 H2 allele (H1/H2, n=21), and 82.4% in the 3 subjects carrying 2 H2 alleles (H2/H2; P=0.0071).
Pierre Fontana et al. Circulation. 2003;108:
Copyright © American Heart Association, Inc. All rights reserved.

6. Figure 5. Maximal aggregation to 1, 2, and 5 μmol/L ADP in 10 carriers (triangles) and 10 noncarriers (circles) of the H2 allele.
Figure 5. Maximal aggregation to 1, 2, and 5 μmol/L ADP in 10 carriers (triangles) and 10 noncarriers (circles) of the H2 allele. A, Citrate-anticoagulated PRP. B, Hirudin-anticoagulated PRP. Mean±SEM.
Pierre Fontana et al. Circulation. 2003;108:
Copyright © American Heart Association, Inc. All rights reserved.

7. Figure 6. Inhibition of iloprost-induced cAMP formation by ADP in carriers (triangles) and noncarriers (circles) of the H2 haplotype.
Figure 6. Inhibition of iloprost-induced cAMP formation by ADP in carriers (triangles) and noncarriers (circles) of the H2 haplotype. A, Citrate-anticoagulated PRP. B, Hirudin-anticoagulated PRP. Iloprost (20 μg/μL final concentration) was added to citrated PRP 1 minute after incubation at 37°C. Saline (control) or ADP at 1, 2, or 5 μmol/L was added 1 minute later. The reaction was stopped 3 minutes later, and the cAMP concentration was determined by using a commercial assay kit. Mean±SEM.
Pierre Fontana et al. Circulation. 2003;108:
Copyright © American Heart Association, Inc. All rights reserved.