1. A2 Unit 5
Genetic Control of Protein Structure and Function
Structure of Ribonucleic Acid.

3. DNA – 30 seconds go!

4. DNA

5. RNA
? What is the difference

6. Single mononucleotide chain
Ribose sugar (not deoxyribose as in DNA)
Thymine replaced with Uracil

7. Why?

9. Another Form tRNA (transfer RNA)

10. The Genetic Code: Gene encodes instruction for making a protein
( a polymer of amino acids in a certain sequence)
Each amino acid is encoded by a triplet of three nucleotides.
Degenerate, this means that most amino acids have more than one triplet code
Leucine has six different codons UUA, UUG, CUU, CUC, CUA, CUG
Non overlapping
Each base is only read once ie)
six bases
are read as
and not
Universal the codon codes for the same amino acid in any organism.

13. Transcription

14. Translation

21. Translation

22. ACTCGCGCGAATTCGTTGGCCACCGAGTAG
This is the coding strand of a gene:
ACTCGCGCGAATTCGTTGGCCACCGAGTAG
Can you TRANSLATE it into a protein.

25. Gene Mutation

26. THE CAT SAT ON THE MAT THE CAT SAT ON THE HAT
Now insert the letter H after the S.

29. CANCER

30. Protooncogenes

31. Tumour Suppressor

32. Regulation of Transcription and Translation
How does Oestrogen control gene expression.
Small interfering RNA

35. Key words / phrases to think about.
Transcription
Gene Expression
Lipid soluble
DNA binding site
DNA Protein complex
Inhibitor protein
Receptor site
Conformational Change in shape

37. “small interferring RNA”
Alternatively regulate gene exression through targeted degradation of mRNA
A process of :
Post
Transcriptional
Gene
Silencing
Si RNA
“small interferring RNA”

39. Totipotency and cell specialisation.
Stem cells are found in multicellular organisms they have the ability to divide many times and remain undifferentiated.
The have the potencial to develop into any other cell type. Fundamentally important in both natural development and future therapies.

40. STEM CELLS

41. Totipotent, Pluripotent, Multipotent
Totipotent cells can form all the cell types in a body, plus the extra embryonic, or placental, cells. Embryonic cells within the first couple of cell divisions after fertilization are the only cells that are totipotent.
Pluripotent cells can give rise to all of the cell types that make up the body; embryonic stem cells are considered pluripotent.
Multipotent are undifferentiated cells found in differentiated tissues and organs, these cells can develop into more than one cell type, but are more limited than pluripotent cells; adult stem cells and cord blood stem cells are considered multipotent

43. Embryonic stem cell therapy is cheaper than harvesting stem cells from adults
Harvesting adult stem cells is dangerous to the healthy adult.
Embryonic stem cells are more undifferentiated , allowing them to treat a wider range of diseases.
Research into embryonic stem cell therapy may lead the way for more controversial research such as human cloning.
Approximately 18% of fertilised eggs do not implant after conception. Thus far more embryos are lost due to chance than are proposed to be used for embryonic stem cell research or treatments.
An embryo is actually a human; it should be valued as highly as a human life.
Embryonic stem cells should be abandoned in favour of alternatives, such as those involving adult stem cells.
Embryos are a cluster of human cells that have not differentiated into distinct organ tissue; making cells of the inner cell mass no more "human" than a skin cell
Scientists have long promised spectacular results from embryonic stem cell research, and this has not yet occurred.
In vitro fertilization (IVF) generates large numbers of unused embryos. Many of these thousands of IVF embryos are selected for destruction.
Another concern with embryonic stem cell treatments is a tendency of stem cells from embryos to create cancer tumors.
Embryos, while of value, are not equivalent to human life while they are still incapable of existing outside the womb
The use of embryonic stem cell in therapies may not work, as the therapeutic cells may be rejected by the patient.
Embryonic stem cells divide more rapidly than adult stem cells, potentially making it easier to generate large numbers of cells for therapeutic means. In contrast, adult stem cell might not divide fast enough to offer immediate treatment
Umbilical cord blood has consistently produced more promising results than the use of embryonic stem cells. Furthermore, adult stem cell research may be able to make greater advances if less money and resources were channeled into embryonic stem cell research.
Adult stem cells from the patient's own body might not be effective in treatment of genetic disorders, as these stem cells will also have the genetic disorder.

44. Embryonic stem cell therapy is cheaper than harvesting stem cells from adults
Harvesting adult stem cells is dangerous to the healthy adult.
Embryonic stem cells are more undifferentiated , allowing them to treat a wider range of diseases.
Diamond nine.
Approximately 18% of fertilised eggs do not implant after conception. Thus far more embryos are lost due to chance than are proposed to be used for embryonic stem cell research or treatments.
Embryos are a cluster of human cells that have not differentiated into distinct organ tissue; making cells of the inner cell mass no more "human" than a skin cell
In vitro fertilization (IVF) generates large numbers of unused embryos. Many of these thousands of IVF embryos are selected for destruction.
Embryos, while of value, are not equivalent to human life while they are still incapable of existing outside the womb
Embryonic stem cells divide more rapidly than adult stem cells, potentially making it easier to generate large numbers of cells for therapeutic means. In contrast, adult stem cell might not divide fast enough to offer immediate treatment
Adult stem cells from the patient's own body might not be effective in treatment of genetic disorders, as these stem cells will also have the genetic disorder.