1. Combining genes from two different species
Recombinant DNA
Combining genes from two different species

2. Manipulating Genes
Yesterday you found and translated jellyfish, coral and bacterial genes.
Now what?

3. What are the steps for making a
transgenic organism?
If students did not read the article for homework or previously, insert that activity after this slide, before discussing restriction enzymes. (WS.ArticlePharming.docx)

4. Students should have read the article and answered the questions by now.
Pictures are from

5. How do we make the DNA?
Find the gene for the protein of interest, in both humans and goats.
Cut out the human gene.
Cut the goat gene to “open” it.
Insert the human gene into the opening.

6. Restriction Enzymes/Endonucleases
Enzymes that cut DNA at specific sequences.
Graphic from
“Sticky Ends” h h h h

7. How many pieces? GAATTCCGGCCGAATTCAAGCTT CTTAAGGCCGGCTTAAGTTCGAA
Cut with:
GAATTCCGGCCGAATTCAAGCTT
Cut site graphic from
CTTAAGGCCGGCTTAAGTTCGAA 1 2 3

8. How many pieces? GAATTCCGGCCGAATTCAAGCTT CTTAAGGCCGGCTTAAGTTCGAA
Cut with: 1 2
GAATTCCGGCCGAATTCAAGCTT
Cut site graphic from
CTTAAGGCCGGCTTAAGTTCGAA

9. What if your gene is the highlighted sequence?
Cut with which?
GAATTCCGGCCGAATTCAAGCTT
Cut site graphic from
CTTAAGGCCGGCTTAAGTTCGAA
HindIII for sure, because EcoRI would cut your gene in two!

10. This is a “blunt cut” – harder to put back together again.
How many pieces?
Cut with: 1 2
GAATTCCGGCCGAATTCAAGCTT
Cut site graphic from
CTTAAGGCCGGCTTAAGTTCGAA
This is a “blunt cut” – harder to put back together again.

11. From http://library. thinkquest

12. Vectors
A “vector” is something that carries a specific gene into an organism.
Plasmids are common for bacteria – and what we will use in our simulation.
Diagram from

13. Vectors
Scientists have created special vector plasmids that have “polylinker” regions – lots of choice for cut sites!

14. Simulation Goal
To take the _________________ genes for making proteins that __________________ in different colors (i.e. pink or green), and to insert them into _____________________
JELLYFISH or CORAL
FLUORESCE !
BACTERIA

15. Fluorescence
Absorb energy at one wavelength (e.g. UV) and emit it at another (e.g. visible)
Even though we’re using genes for fluorescent proteins primarily because it is an easily identifiable trait (and pretty, if you do the actual wet lab), they are genes that scientists really do use a lot. Genes for fluorescent proteins are attached to particular proteins or genes that scientists are interested in “watching”. When the genes get turned on – or wherever the tagged proteins go – the fluorescence can be photographed an monitored. This technique enables scientists to literally “see” processes that are normally “invisible” to us:
When specifiic genes get turned on, and where in the body (interesting for monitoring the process of development)
Where particular proteins localize in a cell
How quickly proteins move through a cell, which direction they point, etc.
How particular proteins turn others on/off
The pictures on this page are:
“brainbow” from
Glowing salamander from
Clock is a picture of bacteria in a petri dish, which have been expressing the protein for the number of hours indicated – the color is designed to change over the course of 18 hours:
Sperm (from two different mates – one of each color):

16. Normal Light
UV Light
From
"Ruppy", a beagle, is the first transgenic dog created. She expresses RFP in all her cells, however due to the pigments in her fur the RFP is only visible in places not covered by fur e.g. her paws. Her name ÒRuppyÓ is a contraction of ruby puppy. The description of the creation of the first transgenic dog is presented in the April 8, 2009 issue of Genesis. Ruppy was created to study human genetic diseases Ð dogs and humans have 224 hereditary diseases in common. The RFP gene was inserted using a retrovirus, unfortunately the researches had no control over the location of the gene insertion.
Cats from

17. “Watching” the cell cycle: Cells are red during G1.
Turn yellow at the start of replication.
Turn green during S-phase

18. Studying Cancer with Fluorescence
A mouse’s blood vessels were tagged with green. A human cancer tagged with red was injected into the mouse. Scientists can study how the cancer spreads, and how the blood vessels feed the cancer, to work toward a cure.
From

19. Tracking HIV’s virulence
From
When human T-cells bump into each they form a sticky strand that connects the two cells. These strands dubbed "membrane nanotubes" by the Imperial College scientists who discovered them can connect two T-cells that are several cell lengths apart. By infecting a T-cell with HIV containing GFP labelled proteins the researchers were able to show that HIV proteins travel down the nanotubes from infected to non-infected cells. These nanotubes maybe part of the reason HIV is so effective at spreading rapidly within host bodies.

20. Simulation: Cutting out Genes
Materials:
DNA from yesterday, with highlighted genes
Scissors
Your goal: cut your DNA in such a way that:
The jellyfish/coral gene has “sticky ends” on each side.
You “open” the bacterial plasmid.
The jellyfish/coral sticky ends “fit” in the open bacterial plasmid. (i.e. The bases are complementary.)

21. Clean Up Turn in the worksheet.
Store DNA in Zip-loc for use tomorrow. (Include your names.)