1. Aim: Mutations
Enter Date
Warm-up:
HW:

2. Mistakes in the Making
Sometimes when DNA is copying itself, it can make a mistake.
These mistakes are called mutations
They make changes in our genetic material.

3. Genes Genes code for proteins Proteins create traits
the order of A, T, C & G
Proteins create traits
DNA
TACGCACATTTACGTACGCGG
mRNA
AUGCGUGUAAAUGCAUGCGCC aa
protein
trait

4. Genes code for proteins through…
transcription
translation
trait

5. Mutations Mutations are changes in DNA sequences BB Bb bb
changes to the order of A, T, C & G
different order = different amino acid in protein
different protein structure = different protein function BB Bb bb

6. Mutations Point mutations single base change silent mutation missense
no amino acid change
redundancy in code
missense
change amino acid
nonsense
change to stop codon

7. Point mutation leads to Sickle cell anemia
What kind of mutation?
Missense!

8. Sickle cell anemia Primarily Africans recessive inheritance pattern
strikes 1 out of 400 African Americans

9. Mutations Frameshift shift in the reading frame insertions deletions
changes everything “downstream”
insertions
adding base(s)
deletions
losing base(s)
Where would this mutation cause the most change: beginning or end of gene?

10. Frameshift mutations Deletion Insertion THERATANDTHECATATETHEREDBAT
THERTANDTHECATATETHEREDBAT
THERTANDTHECATATETHEREDBAT
Insertion
THERAATANDTHECATATETHEREDBAT
THERAATANDTHECATATETHEREDBAT

11. Cystic fibrosis Primarily whites of European descent
strikes 1 in 2500 births
without treatment children die before 5; with treatment can live past their late 20s
Cystic fibrosis is an inherited disease that is relatively common in the U.S. Cystic fibrosis affects multiple parts of the body including the pancreas, the sweat glands, and the lungs. When someone has cystic fibrosis, they often have lots of lung problems. The cause of their lung problems is directly related to basic problems with diffusion and osmosis in the large airways of the lungs.
People without cystic fibrosis have a small layer of salt water in the large airways of their lungs. This layer of salt water is under the mucus layer which lines the airways. The mucus layer in the airways helps to clear dust and other inhaled particles from the lungs.

12. Effect on Lungs Cl- Cl- bacteria & mucus build up H2O H2O airway
normal lungs
airway
Cl-
H2O
cells lining lungs
thickened mucus hard to secrete
cystic fibrosis
Cl-
In people without cystic fibrosis, working cystic fibrosis proteins allow salt (chloride) to enter the air space and water follows by osmosis. The mucus layer is dilute and not very sticky.
In people with cystic fibrosis, non-working cystic fibrosis proteins mean no salt (chloride) enters the air space and water doesn't either. The mucus layer is concentrated and very sticky.
People with cystic fibrosis have lung problems because:
Proteins for diffusion of salt into the airways don't work. (less diffusion)
Less salt in the airways means less water in the airways. (less osmosis)
Less water in the airways means mucus layer is very sticky (viscous).
Sticky mucus cannot be easily moved to clear particles from the lungs.
Sticky mucus traps bacteria and causes more lung infections.
Therefore, because of less diffusion of salt and less osmosis of water, people with cystic fibrosis have too much sticky mucus in the airways of their lungs and get lots of lung infections. Thus, they are sick a lot.
H2O
bacteria & mucus build up

14. Mermaid Syndrome
Mermaid Syndrome

15. Chromosomal Mutations
This involves changes in the number or structure of chromosomes
This will cause a change in the location or copy of some genes.
Sometimes a mutation occurs giving an organism extra sets of chromosomes known as polyploidy.

16. Not all Mutations are Bad
Most mutations are not expressed in an organism.
Good mutations can help an organism become more successful in the environment.
It can also give animals genetic variability.

17. Genetic Disorders
Dominant Allele disorders can occur even when a recessive allele is present. These are very rare.
Examples – Dwarfism and Huntington’s disease.

18. Sex – Linked Disorders
Colorblindness – caused by a defective recessive gene on the X chromosome.
Hemophelia – Found on the X chromosome on two recessive genes. A protein that helps clot blood is made incorrectly.
Muscular Dystrophy – the progressive weakening and loss of skeletal muscle. The body produces defective muscle proteins.

19. Chromosomal Disorders
Down Syndrome – Three chromosomes present at the 21st chromosome. Trisomy 21 is caused by nondisjunction.
Nondisjunction is when a chromosome fails to separate during mitosis.
Sex Disorders – Turner’s Syndrome and Klinefelter’s Syndrome have an extra sex chromosome or a lack of a sex chromosome.
Turners – X and Klinefelters – XXY or XXXY