1. DNA Profiling
Forensic Science
Florio

2. Learning Sequence History, DNA Structure, Chromosomes Sources of DNA
DNA and the Crime Scene
Methods of DNA Typing
Process of DNA Typing
CODIS

3. Brief History
American researchers discovered non-coding regions of DNA
Professor Alec Jeffreys developed the process of DNA profiling
First conviction based on DNA evidence

4. DNA What is DNA? How does DNA work? Why test DNA?
Where can DNA be located?
Biological tissues?
Evidence collection?
How can DNA be used to potentially identify an individual?
Can DNA evidence be destroyed or contaminated?
To what extent is DNA profiling accurate?

5. What is DNA? Double stranded helix Polymer Nucleus
Mitochondria
Sugar, phosphate and 4 types of bases (A,T,C,G) = NUCLEOTIDE
-Hydrogen bonds
Skin cell
Skin cell DNA

7. What is DNA?

8. What is DNA? Chromosomes
From mom
From dad
22 pairs total
(traits) +
X,Y or XX
Male
Female

9. Important Definitions
Genes – DNA sequences that have instructions that determine our inherited traits
Allele – one of two or more alternative forms of a gene (1 from mom, 1 from dad)
Polymorphism – differences in DNA sequences; vary in length, bases, and number of repeats

10. Review of DNA What does DNA do? How is it copied during mitosis?
Make proteins!
DNA  mRNA  Proteins
How is it copied during mitosis?
DNA Replication!

11. Why Test DNA? Human Identity Testing
Forensic cases -- matching suspect with evidence
Paternity testing -- identifying father
Historical investigations
Missing persons investigations
Mass disasters -- putting pieces back together
Military DNA “dog tag”
Convicted felon DNA databases

12. Where can DNA be located? (Biological tissue)
Blood
Semen
Saliva
Urine
Hair
Teeth
Bone
Tissue

13. DNA and the Crime Scene
You could have a scene that looks like this…

14. DNA and the Crime Scene
Or a scene that looks like this…

15. What are some sources of DNA at this scene?

16. Sources of DNA Evidence
Possible Location of DNA on the Evidence
Source of DNA
baseball bat or similar weapon
handle, end
sweat, skin, blood, tissue
hat, bandanna, or mask
inside
sweat, hair, dandruff
eyeglasses
nose or ear pieces, lens
sweat, skin
facial tissue, cotton swab
surface area
mucus, blood, sweat, semen, ear wax
dirty laundry
blood, sweat, semen
toothpick
tips
saliva
used cigarette
cigarette butt
stamp or envelope
licked area
tape or ligature
inside/outside surface
skin, sweat
bottle, can, or glass
sides, mouthpiece
saliva, sweat
used condom
semen, vaginal or rectal cells
blanket, pillow, sheet
sweat, hair, semen, urine, saliva
"through and through" bullet
outside surface
blood, tissue
bite mark
person's skin or clothing
fingernail, partial fingernail
scrapings
blood, sweat, tissue

17. DNA and the Crime Scene The Method of DNA Typing depends on…
How much DNA you have (# of cells)
Condition of the DNA
Nature of the crime

18. DNA and The Crime Scene

19. DNA and The Crime Scene Packaging
All clothing packaged separately in breathable bags or boxes
Dried blood – remove with moisten cotton swab
Acquire a substrate control – unstained portion of surface on which bio material has been deposited – compare to stained area

20. Packaging DNA

21. DNA and The Crime Scene Packaging
All swabs and evidence must be air dried!
Refrigerated
Obtain buccal swabs from suspects

22. Polymorphism critical to distinguish individuals
GATCTAGCTAGCTACCTAGCTATCCTAGC
GATCTAGCTTGCTACGTAG-TATCCTAGC
eg Single Nucleotide Polymorphism B.
GCTGCTGCTGCTGCTGCTGCTGCTGCT
GCTGCTGCT GCT
eg Repeat unit (including Short Tandem Repeats - STRs)
Individuals differ on average by 0.1% at the DNA level = 3.4 million base pairs

23. What patterns do we observe in our genomes?
AGCTGACTGACTTTCAGCTAGC
TACACGTACGCTAGCTAGCTAG
ACTAGCATGCATGCCATGCCAT
GCCATGCCATGCCATGCCATGC
CATGCCATGCCCATGCTAACTT
GATCGGACCGCGCGCTAGCTAG
CTAGCTACACTGCTAGCCCGAT
CGCTAGCCTAGCAGCTGGT

24. What is DNA Profiling? DNA PROFILING
A process or technique of analysis revealing unique patterns of an individual’s DNA involving non-coding regions

25. Steps in Analysis DNA Extraction and Quantitation
DNA Amplification (STR Testing) or Digestion (RFLP testing)
DNA Product Separation
Data Interpretation
Communication of Results

26. (Restriction Fragment Length Polymorphisms - RFLP)
9-80 bases in length
Non-coding regions
Pieces cut by restriction enzymes
Number of repeats varies from one person to the next

27. STRs Short Tandem Repeat (STR)
Repeats of 2-5 or 3-7 bases (dependent on source)
Shorter than samples needed for RFLP
High degree of polymorphism
Greater variation in # of repeats
More preferred method of analysis
Larger the strand, harder it is to separate sequences

28. What makes Short Tandem Repeats (STR) good markers?
Repetitive sequences on all human chromosomes
High degree of genetic variability
Sensitive and rapid detection
Several loci can be combined in a single test

29. Identifying an individual?
Techniques?
RFLP analysis
STR analysis
We need more DNA!!!!!!!
Polymerase chain reaction (PCR)

30. STAGES INVOLVED - RFLP Cells broken down to release DNA
DNA strands cut into fragments
Fragments separated
Pattern of fragments analyzed

31. DNA Profiling RFLP Extract DNA sample Digest DNA sample Collect DNA
Gel electrophoresis
Label and
analyze
Separate fragments by (via charge)
molecular weight

32. DNA Profiling PCR/STRs
Extract DNA sample
Collect DNA
PCR amplification
Capillary electrophoresis

33. 1) DNA Extraction

34. 2) Not enough DNA? Amplification is the answer!
Polymerase chain reaction (PCR)
Small quantities of DNA/broken pieces of DNA can be copied
Use enzyme DNA Polymerase
1 DNA molecule
1 million DNA molecules
Sample size

35. PCR
What part of the DNA is amplified?
Short repeated segments (STRs)

36. PCR Purpose – Quickly make many copies of a region of a DNA molecule
Method – Multiple rounds of DNA replication using a Thermal Cycler
* each cycle doubles amount of DNA until millions of copies are produced

37. Multiplex PCR Over 10 Markers Can Be Copied at Once
Sensitivities to levels less than 1 ng of DNA
Ability to Handle Mixtures and Degraded Samples
Different Fluorescent Dyes Used to Distinguish STR Alleles with Overlapping Size Ranges

38. 2) Enzyme Digestion - RFLP testing only

39. Enzyme Digestion Restriction enzymes added to sample DNA
DNA cleaved at specific sites
Due to varying number of repeated segments at these sites, DNA will be cut in varying lengths

40. 3) DNA Product Separation - Methods of Analysis
Restriction Fragment Length Polymorphism (RFLP)
Short Tandem Repeat (STR)
* Y-STR
Mitochondrial DNA

41. RFLP - Gel Electrophoresis
Fragments separated by
length
DNA (negatively
charged)
Moves towards +ve terminal
Shorter fragments move faster

42. RFLP - Gel Transfer
DNA fragments transferred from gel to filter paper or nylon membrane. (This is called Southern blotting)
Gel, with filter paper attached, is removed & separated

43. RFLP - Addition of DNA Probes
Radioactive probe in solution binds to DNA
Revealing a pattern of bands
X-ray film

44. How Do DNA Probes Work?

45. STR -Capillary Electrophoresis
Used with STR analysis
Quick and can be automated
Carried out in thin, glass capillary column
2 reservoirs hold buffers connected to high voltage
Process
DNA injected into capillary tube
STR fragments move b/c of electrical potential
DNA segments move through DETECTOR
Data displayed on ELECTROPHEROGRAM

46. Capillary Electrophoresis

47. ABI Prism 310 Genetic Analyzer
capillary
Syringe with polymer solution
Autosampler tray
Outlet buffer
Injection electrode
Inlet buffer

48. 4) Data Interpretation: Electropherogram

49. Electropherogram with amelogenin – determines sex

50. Y STR Analysis Locates STRs on the Y chromosome Look for about 17 STRs
Helpful with sexual assaults or when more than 1 male involved
Vaginal swabs
Saliva
Blood

51. Mitochondrial DNA Analysis
Inherited from mother
Single mito contains many loops of DNA
Each cell contains mito
Useful when nDNA is degraded

52. Mitochondrial DNA Analysis
Charred remains
Old remains
Hair
Mass Disasters
Historic Investigations
Need living maternal relative for a match

53. Mitochondrial DNA Analysis
Constructed in circular loop
Single mito contains many loops of DNA
Each cell contains mito
Useful when nDNA is degraded

54. Sensitivity Can perform STR analysis on as little as 125 picograms
Human cell = 7 pg
You need about 18 cells
New modification to technology allow for even fewer (9 cells)
DNA below the normal level of detection = LOW COPY NUMBER
Sources – touch DNA, licked envelopes

55. Low Copy Number

56. Challenges with DNA profiling
Mixtures must be resolved (2 people in a fight, blood is mixed)
Contamination
DNA is often degraded
Inhibitors to PCR are often present (dirt, soils, dyes)

57. Degradation of DNA
Heat
UV light
Contaminating bacteria

58. FBI’s CODIS DNA Database
Combined DNA Index System
Used for linking serial crimes and unsolved cases with repeat offenders
Launched October 1998
Links all 50 states
Requires >4 RFLP markers
and/or 13 core STR markers
Current backlog of >600,000 samples

59. 5) Communication: 13 Core Loci
13 regions on various chromosomes
High variable regions
Frequency that 2 people will have the same sequence at that region is rare
Depends on ethnicity/race
Odds of two caucasian individuals possessing the same 13 STRs = 1 in 575 trillion and 1 in 900 trillion in African Americans)