Download presentation
Presentation is loading. Please wait.
1
AMPLIFYING AND ANALYZING DNA
2
Amplifying DNA a. Recombinant DNA
3
AMPLIFYING DNA B. Polymerase Chain Reaction (PCR) ***Not for sequencing DNA*** 1 – Use a high heat to separate DNA strands (94–98 °C for 20–30 seconds.) 2 – Drop the temperature to allow primers to bind (50–65 °C for 20–40 seconds) 3 – Increase temperature slightly to allow for DNA replication (Taq - 75–80 °C) The method relies on thermal cycling, consisting of cycles of repeated heating and cooling of the reaction for DNA melting and enzymatic replication of the DNA. Primers (short DNA fragments) containing sequences complementary to the target region along with a DNA polymerase (after which the method is named) are key components to enable selective and repeated amplification. As PCR progresses, the DNA generated is itself used as a template for replication, setting in motion a chain reaction in which the DNA template is exponentially amplified. PCR can be extensively modified to perform a wide array of genetic manipulations. You would clone the gene using the polymerase chain reaction. The steps would include a. selecting two primers that would flank the gene b. heating the DNA to separate the strands c. reducing the temperature and annealing the primers to the DNA strands d. raising the temperature and extending the primers using Taq polymerase repeating this cycle a number of times Most DNA polymerases (enzymes that make new DNA) work only at low temperatures. But at low temperatures, DNA is tightly coiled, so the polymerases don't stand much of a chance of getting at most parts of the molecules. But these thermophile DNA polymerases work at 100C, a temperature at which DNA is denatured (in linear form). This thermophilic DNA polymerase is called Taq polymerase, named after Thermus aquaticus, the bacteria it is derived from. Taq polymerase, however, has no proofreading ability. Other thermally stable polymerases, such as Vent and Pfu, have been discovered to both work for PCR and to proofread
4
PCR Machine
5
GEL ELECTROPHORESIS Gel electrophoresis is the movement of charged particles under the influence of an electric field. It is used to separate macromolecules like nucleic acids and proteins on the basis of size and charge (like a sieve) DNA is a negatively charged particle…why? DNA fragments are made using restriction enzymes cutting the DNA strand at specific locations. Depending on where they cut, they form different length segments that migrate up to certain points on across the gel Smaller DNA fragment travel fastest through pores to reach positive end Once fragments have separated, a molecular marker is used to determine size of bands Goal of electrophoresis is to compare size of DNA from unknown sample to known sample.
6
USE TTCC RESTRICTION ENZYME
EXAMPLE USE TTCC RESTRICTION ENZYME DNA SAMPLE ONE: ACTGTTCCACACTTCCGCACATCTTAATTCC Forensics In the world of forensics, gel electrophoresis is used to obtain a DNA fingerprint of a criminal. This means that scientists can accurately tell whether two pieces of DNA, one found at a crime scene and one belonging to a suspect, are matches. Molecular Biology Microbiologists use gel electrophoresis on a regular basis. The process allows them to separate and organize DNA and RNA by size, thus making it easier to study them at the molecular level. Read more: What Can Gel Electrophoresis Be Used For? | eHow.com
7
METHODS FOR ESTABLISHING PATTERNS IN DNA
A. USING NON-CODING DNA A lot more variability in non-coding DNA have alleles that have different numbers of random repeats EXAMPLE ONE INDIVIDUAL: TTAAGGTTAAGGTTAAGGTTAAGGTTAAGG TTAAGGTTAAGG As each person has two copies of each chromosome, they will each have two copies of a specific number of repeats of sequences (usually three to five letters in length; called short tandem repeats - STRs) ‘Non-coding’ DNA does not contain the coded messages that the cells use and sometimes has been erroneously referred to as ‘junk’ DNA. Each person has two copies of each chromosome. So each person will have a specific number of repeats at each of these loci on one of their chromosomes and the same, or different, number of repeats, at the partner locus on the other chromosome. These different forms at the same sites on the partner chromosomes are called alleles of the locus. This information is used to create a DNA pattern or DNA fingerprint that is as unique as possible for each person as described below.
8
Sanger Method Load The Sanger sequencing reaction. Single stranded DNA is amplified in the presence of fluorescently labelled ddNTPs that serve to terminate the reaction and label all the fragments of DNA produced. The fragments of DNA are then separated via polyacrylamide gel electrophoresis and the sequence read using a laser beam and computer. a primer of known sequence is required for each sequencing reaction. Thus, one cannot take any piece of DNA and “just sequence it.” A known starting point, and thus some knowledge of the sequence, is required to begin the reaction.
9
C. SANGER TECHNIQUE When replicating DNA segments, use regular nucleotides and dideoxynucleotides for the construction of the new DNA segment. Dideoxynucleotides (dd-A, dd-T, dd-C, dd-G) lack a 3’ OH group on the deoxyribose therefore if it is added to the growing DNA segment, then another nucleotide can not be attached to that segment and therefore terminating the segment prematurely. Fragments of the DNA segment are made varying in length. Gel electrophoresis is used to separate the fragments according to size. The bands indicate where a certain nucleotide is located on the segment of DNA. To analyze the entire sequence, you can run parallel gels using dd-A, dd-T, dd-C, and dd-G.
10
TEMPLATE T C G C A T A G C C
11
STRAND A G C G T A T C G G A G C T
12
Newer Modification An electropherogram of a finished sequencing reaction. As the fragments from the sequencing reaction are resolved via electrophoresis, a laser reads the fluorescence of each fragment (blue, green, red or yellow) and compiles the data into an image. Each colour, or fluorescence intensity, represents a different nucleotide (e.g. blue for C) and reveals where that nucleotide is in the sequence.
13
Detect specific DNA sequence
SOUTHERN BLOTTING Detect specific DNA sequence a process used to move DNA segments from a gel solution to a filter sheet. There is also Western, Northern, and Eastern Blots A Southern blot is a method routinely used in molecular biology for detection of a specific DNA sequence in DNA samples. Southern blotting combines transfer of electrophoresis-separated DNA fragments to a filter membrane and subsequent fragment detection by probe hybridization. 1) DNA (genomic or other source) is digested with a restriction enzyme and separated by gel electrophoresis, usually an agarose gel. Because there are so many different restriction fragments on the gel, it usually appears as a smear rather than discrete bands. The DNA is denature into single strands by incubation with NaOH. 2) The DNA is transfered to a membrane which is a sheet of special blotting paper. The DNA fragementsw retain the same pattern of separation they had on the gel. 3) The blot is incubated with many copies of a probe which is single-stranded DNA. This probe will form base pairs with its complementary DNA sequence and bind to form a double-stranded DNA molecule. The probe cannot be seen but it is either radioactive or has an enzyme bound to it (e.g. alkaline phosphatase or horseradish peroxidase). 4) The location of the probe is revealed by incubating it with a colorless substrate that the attached enzyme converts to a colored product that can be seen or gives off light which will expose X-ray film. If the probe was labeled with radioactivity, it can expose X-ray film directly.
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.