1. Applications in Biotechnology
Honors Biology
Ms. DiSantis

2. Lesson Overview and How I Taught the Lesson
What is DNA Barcoding?
Students already had an understanding of DNA structure, nucleotide sequences, replication, protein synthesis and mutations.
Explained how barcoding uses a very short genetic sequence from a standard part of the genome the way a supermarket scanner distinguishes products using the black stripes of the Universal Product Code (UPC).
The gene region that is being used as the standard barcode for almost all animal groups is a 648 base-pair region in the mitochondrial cytochrome c oxidase 1 gene (“CO1”).
So what is Mitochondrial DNA or (mtDNA)? It is found inside of mitochondria and is unlike the DNA inside the nucleus in that all of it comes from our mothers. This is because mtDNA is transmitted through the female egg. 
You will be doing a Webquest tonight for homework to become more familiar with mtDNA.

3. How Bar coding works

4. The Lesson: A Whale of a Tale Using BLAST
Created By:
Jayne Ricciardi and Beth Marass
Special guest appearance
Katie Lodes
Published By:

5. Homework - Mitochondrial DNA Webquest
Objective – To familiarize yourself with what mitochondrial DNA is, where it is found, how it is used and what it is used for (See handout).
Part I: What is Mitochondrial DNA?
Go to the National Institute of Health’s Genetics Home Reference Page on Mitochondrial DNA at:
Part II: Why do Mitochondria have DNA?
Go to the Genetic Science Learning Center’s Evolution of the Cell page at:
Part III: Why Do We Inherit Mitochondrial DNA only from our Mothers?
Go to the New York Times article titled “Why Do We Inherit Mitochondrial DNA only from our Mothers?” mothers.html

7. Day 2 – Overview of The Lesson
The Scenario and Objectives:
There are 3 options in this Lesson – we did option #2 Whale Meat Restaurant
The Lesson focuses on a wildlife crime and forensics mystery with meat found at a restaurant (see handout).
You will be using a Bioinformatics tool called Basic Local Alignment Search Tool (BLAST) to identify unknown mtDNA sequences.
You will be given 4 unknown mtDNA sequences to identify and conduct background research and answer questions.
Lets read over the lesson scenario and instructions together (see handouts).

8. Scenario
After receiving a tip that a restaurant in New York City was serving whale meat, the police conducted a raid and found containers in the refrigerator.
The Marine Mammal Protection Act of 1972 makes it illegal for any person residing in the United States to:
Kill, hunt, injure or harass all species of marine mammals, regardless of their population status
Import marine mammals or products made from them into the United States 
Possession of the whale meat is a serious crime. For violating the Marine Mammal Protection Act, the restaurant owners could be facing a civil penalty and criminal penalties. If the whale meat came from an endangered species, the penalties are even steeper, including larger fines.
The restaurant owners claim the confiscated meat pieces were actually venison. The restaurateurs claim they were deceiving customers by passing off the much less expensive deer meat as whale meat, which people say has a similar flavor. You be the judge! 
You are part of the NOAA (National Oceanic and Atmospheric Administration) Law Enforcement team. Your task is to identify if these samples are, in fact, whale meat. If they are, you will also need to determine the species of whale from which the meat samples came in order to properly prosecute the restaurant owners. To do this, you will take mitochondrial DNA sequences from the suspected whale meat samples and compare them to the known sequences of different whale species using BLAST (Basic Local Alignment Search Tool) from the National Center for Biotechnology Information (NCBI). You will also determine if in fact it is whale meat, if any of the identified species are on the threatened and endangered species list.

11. A Whale of a Tale: https://blast.ncbi.nlm.nih.gov
Using BLAST to Identify the Source of Mitochondrial DNA from Whales
Copy and paste each of these mtDNA sequences, one at a time, into the Nucleotide BLAST “Enter Query” section on the NCBI BLAST website.
Sample #1
AGAAGCATCACACTCCACCATCAGCACCCAAAGCTGAAATTCTATATAAACTATTCCCTGAAACATGTAT ATTGTACAATAACCGCAAAGCCACAGTACTATGTCCGTATTAAAAAATAATTATCTCATTACATATTGTT ATGTACTTCGTGCATGTATGTACTCCCCCATAACCAGTTAATCAGTGTTATCCCTGTGAATATGTATACA TACACATGCTATGTATAATTGTGCATTCAATTATCTTCACCACGAGCAGTTAAAGCCCGTATTAAATTTT ATTAATTTTACATATTACATAATATTTATTAATAGTACAGTAGTACATGTTCTTATGCATCCTCAGGTCA ATTTAAATCAAATGATTCCTATGGCCGCCCCATTAGATCACGAGCTTAATCACCATGCCGCGTGAAACCA GCAACCCGCTTGGCAGGGATCCCTCTTCTCGCACCGGGCCCATTACTCGTGGGGGTAGCTATTTAATGAT CTTTATAAGA
Sample #2
CATAAACTATTCCCTGAAAAATGTATATTGTACAAGAACCACAAGGCCACAGTACTATGTCCGTATTGAA AATAGCTCATTCCATTACATACCATTATGTAATTCGTGCATGTATGTACTACCACATAACCAACTGATAG CACCTTCCATGAGTATGTATAATCGTGCATTCAATTATTTTCACTACGAGCAGTTAAAGCTCGTATTAAA TTTTATTAATTTTACATATTACATAATATGTATTAATAATACAATAGTACATGTCCTTATAAATTCCCAG GTTTATTTAAATCAAATGATCCCTATGGCCGCTCCATTAGATCACGAGCTTAACTAGCATGCCGCGTGAA ACCAGCAACCCGCTCGGCAGGGATCCCTCTTCTCGCACCGG
Sample #3
ACCCTATACTTATTATTCGGTGCTTGAGCAGGAATAGTAGGCACTGGCCTAAGCTTATTAATCCGCGCTG AACTAGGTCAACCTGGCACACTAATCGGAGATGACCAAGTCTACAACGTATTAGTAACAGCCCATGCTTT CGTGATAATTTTCTTCATGGTTATACCTATCATAATTGGCGGATTCGGAAACTGACTAGTCCCACTAATA ATTGGAGCACCTGACATAGCTTTCCCTCGTATAAATAATATAAGCTTCTGACTACTCCCTCCTTCTTTTT TACTGTTAATAGCATCCTCAATAATCGAAGCCGGTGCAGGCACAGGCTGAACTGTATATCCCCCCTTAGC CGGAAATTTAGCACATGCAGGAGCCTCAGTTGACCTTACCATCTTCTCCCTACACTTAGCCGGCGTATCC TCAATCCTCGGAGCCATCAACTTCATCACAACCATTATCAACATAAAACCGCCCGCCATAACCCAGTATC AAACTCCTCTTTTCGTATGATCAGTCCTAGTCACAGCAGTACTACTCCTATTATCACTACCTGTTTTAGC AGCCGGAATTACAATGCTACTTACTGACCGAAACCTGAATACAACTTTCTTCGACCCTGCAGGTGGAGGA GACCCAATCCTAT
Sample #4
AACCGCTGACTATTCTCAACCAACCACAAAGACATCGGCACCCTGTATTTACTATTTGGTGCCTGAGCAG GAATAGTAGGCACCGGCCTAAGCTTACTAATTCGCGCTGAGCTAGGCCAGCCTGGCACACTAATCGGAGA CGACCAAGTCTACAATGTATTGGTAACAGCCCACGCCTTCGTAATAATCTTTTTCATGGTCATGCCTATT ATAATTGGCGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCACCCGACATAGCTTTCCCCCGTA TAAATAATATAAGCTTCTGACTACTTCCTCCTTCTTTTTTACTACTAATAGCATCTTCAATAGTCGAGGC TGGTGCGGGTACAGGCTGAACTGTATATCCTCCTTTAGCCGGAAACCTAGCACATGCAGGAGCCTCAGTT GACCTCACCATCTTCTCCCTACACCTAGCCGGCGTATCCTCAATCCTCGGAGCCATCAACTTCATCACAA CTATCATCAATATAAAACCACCTGCTATAACCCAATATCAAACTCCCCTTTTCGTATGATCCGTCCTAGT CACGGCAGTACTACTCTTACTATCATTACCCGTCTTAGCAGCCGGAATCACTATACTACTTACTGACCGA AACCTAAA

15. Sample #1
AGAAGCATCACACTCCACCATCAGCACCCAAAGCTGAAATTCTATATAAACTATTCCCTGAAACATGTAT ATTGTACAATAACCGCAAAGCCACAGTACTATGTCCGTATTAAAAAATAATTATCTCATTACATATTGTT ATGTACTTCGTGCATGTATGTACTCCCCCATAACCAGTTAATCAGTGTTATCCCTGTGAATATGTATACA TACACATGCTATGTATAATTGTGCATTCAATTATCTTCACCACGAGCAGTTAAAGCCCGTATTAAATTTT ATTAATTTTACATATTACATAATATTTATTAATAGTACAGTAGTACATGTTCTTATGCATCCTCAGGTCA ATTTAAATCAAATGATTCCTATGGCCGCCCCATTAGATCACGAGCTTAATCACCATGCCGCGTGAAACCA GCAACCCGCTTGGCAGGGATCCCTCTTCTCGCACCGGGCCCATTACTCGTGGGGGTAGCTATTTAATGAT CTTTATAAGA

16. Day 3 – Fish Tale Has DNA Hook: Students Find Bad Labels
Additions to the Lesson
Day 3 – Fish Tale Has DNA Hook: Students Find Bad Labels
Together we will read the John Schwartz article published in the New York Times, August 22, 2008 about teenagers Katie Stoeckle and Louisa Straus and what they discovered while conducting a science project.

18. Okay – it’s Your turn (investigate further)
Additions to the Lesson
Okay – it’s Your turn (investigate further)
Use the internet and find another article that is about using mtDNA to uncover a mystery or an article about the uses of Barcoding.
After reading the article, complete the Article Analysis form (see handout).

21. Students loved the forensic and investigative nature of the lesson.
Student Comments
BLAST is easy to use and they loved using tools similar to real scientists.
Students loved the forensic and investigative nature of the lesson.
Thought the topic was very interesting and relatable.
Loved the fact that two teenagers found and uncovered that some sushi restaurants in New York were not selling what they claimed to be selling.