1. Chapter 4 Section 1 Pages 86-89
What Does DNA Look Like?
Chapter 4 Section 1 Pages 86-89
Liz LaRosa

2. Deoxyribonucleic Acid
What is it?
A molecule.
Where is it found?
In the nucleus of every living cell.
What is its function?
Determines inherited characteristics

3. Shape: Double Helix (Twisted Ladder)
Components to the sides of the ladder:
Sugar and a phosphate molecule
Pattern – The sugar and phosphate alternates.
Component to the rungs of the ladder:
Nitrogen Bases
Adenine always pairs with Thymine
Guanine always pairs with Cytosine

4. Discovering the structure of DNA
Erwin Chargaff – ( )
Columbia University, NY
Investigated the composition of DNA
His findings by 1950 strongly
suggested the base-pairings
of A-T & G-C
Met with Watson and Crick in
1952 and shared his findings
“Chargaff’s rule” A = T & C = G

5. Discovering the structure of DNA
Rosalind Franklin ( )
King’s College, London
Made significant advances in
x- ray diffraction techniques
with DNA
Her images suggested that
DNA had a spiral shape
One of her DNA images

6. Discovering the structure of DNA
James Watson (1928) and Francis Crick ( )
Worked together at Cavendish Laboratory in Cambridge
to determine the structure of DNA
Used work from Franklin, Wilkins (worked with Franklin), and Chargaff to determine the double helix shape
Watson, Crick, and Wilkins
were awarded the Nobel Prize
Rosalind Franklin passed away
(1958) before the Nobel Prize
was awarded in 1962

7. DNA – What does my code look like?
Computer Code:
DNA Code:
ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases…
“Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law

8. G A T T A C C T A A T G Groups of 3 = Codon Practice DNA Base Pairs
“Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law
Groups of 3 = Codon

9. Making Copies of DNA -Replication
DNA helix unzips (unwinds)
Each side is now a pattern.

10. Matching nucleotides pair up with the exposed pattern (exact pattern is copied).

11. Result = 2 identical strands of DNA
½ of the old strand and ½ is the new strand
Original DNA strands