1. Skin Pigmentation: Population Genetics www.evo-ed.org
slide version 1.0

2. Population Genetics of Skin Color
Slide version 1.0

3. Population Genetics Human Skin Color
Learners will be able to:
Describe the basis for determining within and between population genetic differences and apply this information to populations.
Characterize the distribution of variants in five genes across global populations in terms of genetic differences.
Apply known differences in selected genes to the evolution of skin color in humans.

4. Human Skin Color
Skin color varies widely among and between populations. We can observe among our friends and acquaintances that there are gradations in skin color. We also have a pretty good sense that skin color of indigenous populations is correlated with where they are on Earth.
Image from pixabay.com

5. Is there a gene “for” skin pigmentation??
We often hear of a “gene for” a given characteristic. There are only a few examples of a trait being associated with a particular configuration of alleles for a particular gene.
However, most characteristics, as is the case for skin color, are the result of the expression of tens, if not hundreds, of genes each having many forms. This results in an infinite palette of skin color.
We follow the convention that “characteristic” is the phenotype and a “trait” is a variation of that phenotype. Skin color is the characteristic. Brown skin is the trait. Alleles are alternative forms of a gene.

6. Patterns in DNA
Genes are stretches of DNA that code for a protein. Alleles are alternative forms, variants, of DNA that code for a slightly different protein. Sometimes there are small changes in coding DNA. These changes may or may not be associated with a change in protein synthesis. The pattern of these changes in nucleotides in and outside of a coding gene inform us as to relatedness of individuals and populations. Looking at these patterns for many genes and alleles shows the complexity of the expression of skin color.

7. Skin Pigmentation: Genes and Their Variants
The other “islands” in this case address cell biology, selection, genetics, as well as cultural implications of skin color. Here we look at population genetics of skin color through the lens of a few genes. The geographic location and distribution of individuals having known variants of genes involved in making and distributing pigment tells us a lot about the evolution of Homo sapiens. The tools and techniques for getting this information are part of the field of Population Genetics.
Drawing by Robert Krulwich from

8. Population Genetics
Population genetics looks at the genetic differences and similarities both within and between populations.
The techniques used in this field determine evolutionary relatedness and patterns between and among populations.
These patterns also help scientists determine whether or not there has been selection for alternative variants of genes.
This process requires determining frequencies in populations of these variants.

9. What is a population?
A group of individuals of the same species occupying a particular geographic area.
Defining populations can be difficult because there are not always clear boundaries.
In this map of Africa we can see that the distribution of humans is continuous with some areas of high density and others of low density.
Modified figure from

10. Within/Between Populations
In this figure, each loop of the figure eight is considered a separate “population” of buildings. Determining the differences and similarities in the buildings in one loop would be within group sampling. Doing the same for both loops at the same time would be between group sampling.
Image from:

11. Measuring Genetic Variation
Genetic variation can be measured in a variety of ways, for example:
Single Nucleotide Polymorphisms (SNPs)
By looking directly at the DNA sequences we can identify differences in the nucleotides to determine the alleles present in a population
Short Tandem Repeats (STRs)
Alternatively, we can look at the number of repeats of a particular DNA sequence to determine the alleles

12. Genetic Variation: Single Nucleotide Polymorphisms: SNPs
SNPs are differences in a single nucleotide in a stretch of DNA, the basic unit of genetic information. They can occur anywhere in the both coding and non-coding DNA. They can serve as markers in between stretches of coding DNA.
See for further information

13. SNPs
An example of a SNP is a change in the nucleotide G to the nucleotide T. SNPs are very common among human DNA and usually are “silent”: no change in the function of the protein product.
Image from slideshare.net

14. Genetic Variation: Microsatellites aka Short Tandem Repeats (STRs)
STRs are short (only 2 – 5 base pairs), repeating stretches of DNA, almost like a DNA “stutter”. These repeats can be up to 50. The patterns of these “stutters” are shared among populations.
An STR could look this in one population: atcatcatcatcatc And look like this in another: atcatcatcatcatcatcatcatc

15. SNPs and STRs  FST
Scientists can determine the variation in SNPs and STRs in genes and adjacent DNA both within and between populations. This information allows them to determine the genetic variation, π, between populations, a reflection of how populations have evolved. The fixation statistic, FST, is an estimation of differences in populations based on genetic data that ranges from 0 to 1: FST = π between populations – π within populations π between populations
We use the designation of pi to represent genetic variation, although the actual use of pi is specifically measuring nucleotide diversity.

16. What Does FST Indicate?
Population 1
Population 2
FST = 0 The two populations are interbreeding and show insignificant variation (as measured by SNPs and STRs) in the alleles (A, B) of a gene under study. No evolution is occurring. FST = 1 The two populations are very different from one another as evidenced from the alleles of a gene under study; (as measured by SNPs and STRs). Evolution is probably occurring.
A A A A
B B B B
A A A A
B B B B
A A A A
B B B B
FST scores can be calculated for genes known to be involved in skin color pigmentation. They indicate how conserved or different these genes and their alleles are among and between populations.

17. Population Genetics of Skin Color Key Genes
Norton et al. studied the global distribution of variations in six genes involved in skin pigmentation. These genes contribute to two processes.
1. Pathway for making pigment: MC1R ASIP TYR 2. Regulation of amount of pigment made: OCA2 MATP aka SLC45A2 SLC24A5
Photo:
See Norton et al Mol. Bio. Evol. 24: 710 – 722.

18. What Scientists Call the Gene Products (we don’t need to worry about the details)
MC1R melanocortin 1 receptor ASIP agouti signaling protein TYR tyrosinase OCA2 p protein MATP membrane associated transport protein aka SLC45A2 SLC24A5 solute carrier protein

19. First of all: MC1R melanocortin 1 receptor
There are two primary variants of this gene: one gene product promotes the synthesis of a dark pigment, eumelanin. This pigment is a trait of dark skinned people. However, other genes regulate the amount of eumelanin synthesized, producing many shades of tan/brown skin.
The other variant leads to a light pigment, pheomelanin, which is a trait of people with red or blond hair, poorly tanning white skin and freckles.
The pheomelanin variation is greater within populations than between populations. The same is true of the eumelanin form. Because of this, FST values are small and the two major alleles currently are not being subjected to selection in their established populations.
See Norton, et al Mol. Bio. Evol. 24: 710 – 722 for this set of slides.

20. These data are the allele frequencies for the five genes under consideration here. The populations are representative of those from the Norton et al. paper.
The frequencies reflect the occurrence of the gene variant associated with lighter skin.
The maps that follow are based on these data.

21. Interpreting Global Maps
The FST information and maps that follow are primarily based on the work of Norton et al
The circles show the variation in the populations of the alternative forms, determined by SNP data, of five genes studied by Norton et al.
The amount of light gray in each circle represents the relative frequency of the gene variants associated with lighter pigmentation.
Norton et al Mol. Bio. Evol. 24: 710 – 722.

22. Global Distribution: ASIP – Agouti Signaling Protein
ASIP map:
Adapted from Norton, et al Mol. Bio. Evol. 24: 710 – 722.
Amount of light gray represents the relative frequency of allele associated with lighter pigmentation

23. What’s up with ASIP?
This map shows that the variant associated with lighter skin is common among many populations across the Northern hemisphere. Interestingly, it is found in all New World populations sampled as well.
The variant most closely associated with darker skin is found in populations in Africa and and a smattering of populations in Asia.
ASIP probably plays a key role in variation of human skin pigmentation across the globe. The product of the ASIP gene version associated with light skin suppresses eumelanin synthesis and encourages pheomelanin synthesis.

24. Global Distribution: TYR- tyrosinase
TYR map

25. What’s up with TYR?
The variant of the TYR gene associated with light skin is found predominately in European populations.
It is not common in those populations since the ancestral version occurs at a higher frequency.
Notably, this TYR variant is absent in people with lighter skin in East Asia.
One could conclude that the fundamental TYR allele is stable across the planet with the exception of some European populations (and not hugely common there). This makes sense, since tyrosinase is the key enzyme in melanin synthesis and likely to be fairly stable. The alternative form (shown as light grey in circles) probably fosters less pigment synthesis and lighter skin in some people.

26. Global distribution OCA2 - p protein
OCA2 map
From Norton, et al Mol. Bio. Evol. 24: 710 – 722.
Amount of gray represents the relative frequency of allele associated with lighter pigmentation

27. What’s up with OCA2?
A version of the OCA2 gene is associated with lighter skin in Northern hemisphere populations , in European and across Asia.
This version is not common in Native American, African and Melanesian populations.
This suggests that changes in the OCA2 occurred in migrations out of Africa. OCA2 (p-protein) regulates internal pH and thus the amount of tyrosine that enters the melanosome. One could surmise that a key change leading to lighter skin was regulating the amount of pigment made by limiting tyrosine.
Norton, et al Mol. Bio. Evol. 24: 710 – 722.
See Genes and Proteins

28. Global Distribution MATP = SLC45A2- Membrane Associated Transport Protein
MATP Map
From Norton, et al Mol. Bio. Evol. 24: 710 – 722.
Amount of gray represent the relative frequency of allele associated with lighter pigmentation

29. What’s up with MATP = SLC45A2?
FST analysis shows that this variant of the SLC45A2 gene is characteristic of western European populations, in very high percentages.
Only a few people globally share this variation of MATP. It, along with other genes responsible for the “dose” of pigment synthesized, regulates the internal pH of the melanosome.
Norton, et al Mol. Bio. Evol. 24: 710 – 722.
See Genes and Proteins

30. Global Distribution SLC24A5 - solute carrier protein
SLC24A5 Map
From Norton, et al Mol. Bio. Evol. 24: 710 – 722. NEED PETE VERSION
Amount of gray represents the relative frequency of allele associated with lighter pigmentation

31. What’s up with SLC24A5?
FST analysis shows that a variant of the SLC24A5 gene is found throughout Europe and the Near East.
A version associated with darker skin is shared by Asian, African, Melanesian and indigenous North American populations.
If you squint, the Himalayan Mountains forms a border of sorts between the two variants.
These data suggest that a version in this gene associated with light skin are only in the European/near East branch of human migrations.
Like some other genes considered here, the gene product regulates not the kind, but the amount of pigment made in melanosomes.
Norton, et al Mol. Bio. Evol. 24: 710 – 722.
See Genes and Proteins

32. The Bottom Line: What do these data indicate?
Dark skin is typical of African and Melanesian populations. They share variants for the genes considered here, with the exception of that for ASIP.
With the exception of ASIP, Native American populations generally share the ancestral version of these genes, with a few exceptions for the OCA2 gene.
The ASIP variant associated with lighter skin is found throughout the globe, with the exception of Western Africa.
The OCA2 lighter skin variant is found in populations across the Northern hemisphere.
The TYR allele associated with dark skin is prominent throughout the world, with the exception of western Europe.

33. Thus:
Populations with lighter skin commonly share variants for two genes, ASIP and OCA2. These are important for global patterns in skin color.
The SLC24A5,and SLC45A2 variants are common in Europeans, but not East Asians.
TYR is stable around the world, except for western Europe.
The lightest skin color (e.g., Northern England) are associated with the lighter versions of all genes under consideration here.

34. However….
The preceding maps and table show the “mixing and matching” of versions for only five genes. It’s like taking target practice and hitting a subset of the target.
As more is known about the genes related to human skin color and their variants, we can more fully characterize the target. Additionally, as human migrations and interbreeding continue at faster and faster rates, global maps will probably look much different in 200 years.