Download presentation
Presentation is loading. Please wait.
Published byAníbal Alencar Ferretti Modified over 6 years ago
1
DNA Fingerprinting and Forensic Analysis
Chapter 8 Fall 2008
2
Introduction to DNA Fingerprinting and Forensics
Forensic science can be defined as the intersection of law and science First photography-then fingerprint- then, in 1985, DNA Fingerprinting
3
· Variable Number Tandem Repeat (VNTR) - sequences that are repeated multiple times and the number of repeats varies from person to person. GATCGATCGATCGATCGATC – 5 repeats GATCGATC – 2 repeats
4
VNTRs usually occur in introns (noncoding regions of DNA)
VNTRs can be amplified by PCR and run on agarose gels to produce unique DNA fingerprints because the shorter the repeat, the further it will migrate on a gel and vice versa. 5 repeats 2 repeats
5
Preparation of a DNA Fingerprint
Specimen Collection- Could be a licked envelope, dirty laundry, a cigarette butt, saliva Special precautions in handling specimens: gloves, disposable instruments, avoid talking and sneezing, avoid touching sample with your skin, air-dry the evidence before packaging so mold does not grow Enemies of evidence: sunlight, high temperatures, bacteria, moisture Ideal sample: 1 mL of fresh, whole blood (white blood cells) treated with EDTA
7
Victim Crime Scene Suspect
8
DNA fingerprint Like real fingerprints, DNA fragments show unique patterns from one person to the next. Restriction Fragment Length Polymorphism Nucleotide sequence variations in a region of DNA that generates fragment length differences according to the presence or absence of restriction enzyme recognition sites. Used in paternity disputes and as forensic evidence.
10
Figure 8.3
12
Paternity Testing
13
Familial Relationships andDNA profiles
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.