1. Forensic DNA Analysis
M. Phillips, 2014

2. STR: Short Tandem Repeat
STR: Short Tandem Repeat. A section of DNA with 2-10 base pairs repeated back to back. Has forensic value because STRs vary from person to person
VNTR: Variable Number Tandem Repeat. Similar to an STR, but are longer.
Locus: A section of DNA used for comparison between individuals.
PCR: Polymerase Chain Reaction. Process invented to amplify (copy) a small amount of DNA. Works just like replication in the nucleus, but much faster.

3. Restriction Enzyme: An enzyme derived from bacteria that acts as “molecular scissors” to cut DNA at a recognized site.
Restriction Site: A section of DNA that acts as a “dotted line” and tells the restriction enzyme where to cut
Restriction Fragment: The piece of DNA that has been cut out of the DNA by a restriction enzyme

4. Objectives of Forensic DNA Testing
11/10/2018
To link an individual to a crime scene/criminal act
To exonerate suspects
To identify victims of mass disasters
Identify stolen biological property (poaching of plants and animals, kidnapping)
Mass disasters can be either manmade (9/11 act of terrorism) or natural (2005 Indian Ocean Tsunami, 295,000 dead)

5. Mid-1980s: The Colin Pitchfork Case
11/10/2018
Mid-1980s: The Colin Pitchfork Case
Two young women raped and murdered in Narborough, England
5,000 local men are asked to provide blood/saliva samples
1st exoneration and conviction on forensic DNA evidence
“The Blooding” by Joseph Wambaugh, retired LAPD Sergeant

6. Basic Principles The human genome is really, REALLY big
We use restriction enzymes to cut out sections from pre-determined areas to make it easier to compare samples
Sometimes we don’t have enough of a sample and we use a process called PCR to make more
The samples are labeled with a radioactive probe and sorted by size. Then the “DNA fingerprints” can be compared.

7. human genome 3.2 billion bases
TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT
human genome 3.2 billion bases

8.  How do we cut DNA? Restriction enzymes discovered in 1960s
evolved in bacteria to cut up foreign DNA
“restrict” the action of the attacking organism 

9. What do you notice about these phrases?
radar
racecar
Madam I’m Adam
Able was I ere I saw Elba
a man, a plan, a canal, Panama
Was it a bar or a bat I saw?
go hang a salami I’m a lasagna hog
palindromes

10. Restriction enzymes Action of enzyme Many different enzymes
Madam I’m Adam
Action of enzyme
cut DNA at specific sequences
restriction site
symmetrical “palindrome”
produces protruding ends
sticky ends
will bind to any complementary DNA
Many different enzymes
named after organism they are found in
EcoRI, HindIII, BamHI, SmaI 
CTGAATTCCG
GACTTAAGGC 
CTG|AATTCCG
GACTTAA|GGC

11. Restriction enzymes GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA
restriction enzyme cut site
GTAACGAATTCACGCTT
CATTGCTTAAGTGCGAA
restriction enzyme cut site
GTAACG AATTCACGCTT
CATTGCTTAA GTGCGAA

12. Sticky ends GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA GGACCTG AATTCCGGATA
Cut other DNA with same enzymes
leave “sticky ends” on both
can glue DNA together at “sticky ends”
GTAACG AATTCACGCTT
CATTGCTTAA GTGCGAA
gene you want
GGACCTG AATTCCGGATA
CCTGGACTTAA GGCCTAT
chromosome want to add gene to
GGACCTG AATTCACGCTT
CCTGGACTTAA GTGCGAA
combined DNA

13. Few Restriction Enzymes
Enzyme
Organism from which derived
Target sequence (cut at *) 5' -->3'
Bam HI
Bacillus amyloliquefaciens
G* G A T C C
Eco RI
Escherichia coli RY 13
G* A A T T C
Hind III
Haemophilus inflenzae Rd
A* A G C T T
Mbo I
Moraxella bovis
*G A T C
Pst I
Providencia stuartii
C T G C A * G
Sma I
Serratia marcescens
C C C * G G G
Taq I
Thermophilus aquaticus
T * C G A
Xma I
Xanthamonas malvacearum
C * C C G G G

14. How does it Look after Restriction Digestion?
How does it Look after Restriction Digestion?
Genomic DNA Digest Plasmid DNA Digest

15. Early 1980s: Restriction Fragment Length Polymorphism (RFLP)
11/10/2018
Early 1980s: Restriction Fragment Length Polymorphism (RFLP)
Genetic variation in the distance between restriction enzyme sites
Template DNA digested by enzymes, electrophoresed, detected via Southern blotting
Sir Alec Jeffreys
“Please just call me Alec.”

16. 11/10/2018
The Catch:
RFLP testing requires a relatively large amount of DNA (~50ng = thousands of cells)
Not ideal for forensic evidence, in which small, degraded samples are common

17. PCR To The Rescue! Polymerase Chain Reaction = molecular Xeroxing
11/10/2018
PCR To The Rescue!
Polymerase Chain Reaction = molecular Xeroxing
Three temperature phases, carried out in a Thermal Cycler, replicate or “amplify” the desired DNA fragment(s)
Dr. Kary Mullis
Eccentric Genius

18. PCR

19. So how do we know which section to copy?
DNA has about 3 billion base pairs with about 3 million differences between any two individuals.

20. STRs http://vimeo.com/69239594
STR – short tandem repeat in DNA
Occurs when a pattern of TWO or more nucleotides are repeated and the repeated sequences are adjacent to each other.
Pattern can range in length from 2 to 10 bp
Count how many repeats of a specific STR at a given locus can create unique genetic profile
Currently over 10,000 published STR sequences in human genome

21. VNTRs Very similar to STRs, but longer nucleotide sequences
STRs are therefore more efficient for amplification

22. Applied Biosystems 310 Genetic Analyzer
11/10/2018
Applied Biosystems 310 Genetic Analyzer

23. The Process In a Nutshell
11/10/2018
The Process In a Nutshell
Amplified DNA samples are injected into a tube. Fluorescent tags on the DNA fragments are excited by a laser as they pass a window in the capillary, the fluorescence is recorded by a camera, and this signal is converted into a “peak” by the computer software.

24. 11/10/2018
STR data
X, Y,
X Y

25. 11/10/2018
STR data (cont’d)
“The DNA profile obtained from Item 25(S) matches the DNA profile of the suspect. The combination of genetic marker types exhibited by Item 25(S) and the suspect occurs in approximately one in one hundred quadrillion (1017) individuals…”

26. The Combined DNA Index System (CoDIS)
11/10/2018
The Combined DNA Index System (CoDIS)
A database of DNA profiles from violent felons and crime scene samples
Database currently contains about 2,038,470 felons and 93,956 crime scene profiles (19,00 hits so far)

27. The Mystical Power of CoDIS
11/10/2018
The Mystical Power of CoDIS
Extremely powerful investigative tool, linking crimes, and pulling suspects out of thin air!
Can prevent, as well as solve crimes!

28. The Dark Side of CoDIS (What the FBI doesn’t want you to know.)
11/10/2018
The Dark Side of CoDIS (What the FBI doesn’t want you to know.)
DNA mixtures and degraded DNA profiles have lead to spurious matches
Stringent laws explicitly permit databasing innocent people
Adding arrestees to database violates presumption of innocence
However, the prosecution rate on case to offender matches is shockingly low! (~10%)
DNA mixtures can be tricky; requiring close examination of the electronic data, the questioned profile, and the offender “match” profiles. For example, an unknown mixture profile with three alleles at the D21S11 locus, ex. (28, 30, 31) would “hit” on (28, 28), (28, 30), (28, 31), (30, 30), (30, 31), and (31, 31). A total of 6 genotypes. If we designate an obligate or required allele (+), (28, 30+, 31)* would now hit only on the following genotypes: (28, 30), (30, 30), and (30, 31). We have reduced the number of hits at the D21S11 locus by half. Assigning obligate alleles at as many loci as possible can reduce the number of spurious hits to the offender database.
* In this example, which could be a vaginal swab taken from the victim of a sexual assault, the victim was determined to be a (28, 31) at D21S11. Therefore, the 30 allele is foreign to the victim and presumed to be from the suspect.

29. Mitochondrial DNA (mtDNA)
Used for samples that cannot be analyzed using RFLP or STR
Uses DNA extracted from mitochondrion rather than nuclear DNA
Especially useful in old cases and old samples
Single-cell sensitivity because each cell contains ~1000 mitochondria

30. Mitochondrial DNA (mtDNA)
11/10/2018
Mitochondrial DNA (mtDNA)
Cons
Single-cell sensitivity because each cell contains ~1000 mitochondria = very high contamination risk!
Lower power of discrimination - maternal relatives all share the same mtDNA

32. 11/10/2018
Y-STRs
Solution:
Test for markers found only on the Y-chromosome. Only male DNA is amplified!

33. Probe Identification
If you know a specific section of DNA you want, you can use a probe
A complementary strand of DNA or RNA is made and will stick to the target strand by base pairing rules
This probe is labeled with radioactive isotopes or a fluorescing dye
Value – can show different sequences/alleles in similar sized pieces of DNA