1. Lecture 4: Probe & primer design

2. Objective of probe design:
Select a complementary oligonucleotide sequence that is completely specific to a region of the target sequences which has at least one mismatch to the same region in all other (nontarget) sequences.
5’ GUCUAGGGGAUCCCUG 3’
rRNA
3’ CAGAUCCCCUAGGGAC 5’
Probe targets the rRNA
Fluorescent label

3. Fundamentals for probe design
Define the target group
Design a probe
Remember: probe sequence is reverse complement of target
Examine mismatch type & location – require strong and central mismatches to destabilize non-specific binding
Search probe sequence against public sequence databases
Check accessibility of the probe
Check hybridization temperature
Tm > 56°C is ideal

4. Define a target group
Group should be well-supported by bootstrap values

5. Design a probe >> Probe | Design probes Choose your PT-Server
Change Min group hits (%) to 100
Leave other parameters as default

6. Evaluate probe design results
Lots of probe varieties! Which one to pick????

7. About mismatches UACGGUCAAUCGCUUGCG UACGGUCAACCGCUUGCG
An ideal probe sequence will have one or more mismatches to non-target sequences – this ensures that your probe will not hybridize to non-target sequences.
UACGGUCAAUCGCUUGCG
UACGGUCAACCGCUUGCG

8. Evaluate mismatches

9. Mismatches for an ideal probe
Strong mismatches
Non-canonical base pairs (A:A, C:C, G:G, U:U, A:C, C:U) are strongly repulsive (appear in CAPS)
Canonical base pairs (g:a, g:t) are considered ‘weak’ mismatches (appear lowercase)
Mismatches located in center of the sequence destabilize probe more than terminal mismatches

10. Search probe sequence against public databases
Find species not listed in your database which would hybridize to your probe
Conduct a BLAST search with your target string.
Ribosomal DataBase Project’s Probe Match website:
Useful because it categories the phylogenetic grouping of species which hybridize to your probe sequence
Probe Check website:
- Checks your probe against the SILVA or Greengenes databases

11. Check accessibility of the probe
Regions of the SSU rRNa have different accessibilities for probe hybridization
More accessible regions = brighter probe
Check Fuchs et al AEM, 64:
But see also Yilmaz et al AEM, 72:

12. Check melting temperature (Tm)
Melting temperature should be above 56°C
Greater chance of success with hybridization
Tm can be increased by increasing the length of the probe
4GC + 2AT calculation gives you theoretical melting temperature (listed in Probe_Design window)

13. Primer design
Primers are short single-stranded oligonucleotides which anneal to template DNA and serve as a “primer” for DNA synthesis
EXAMPLE:
5’-CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAAGCGAAAAGAGAGACCACAT
>>>>>>>>>>>>>>>>>>>>>
GGTCCTTCTGAGTTTGTAACAGCTGCTGGATTACACAACACATGGCATGGATGA-3’
<<<<<<<<<<<<<<<<<<<<<
Forward primer: 5’- CTGTCCACACAATCTGCC -3’
Reverse primer: 5’- TCATCCATGCCATGTGTT -3’ (reverse complement of target)

14. Objectives for primer design
Select two primers, one flanking each end of the target DNA.
The primers must have a sequence that is complementary to the target DNA.
Choose primer sequences that are completely specific to the target DNA.
Evaluate number of mismatches, as in probe design
Mismatches are ideal when on the ends of sequences
The primers must have similar melting temperatures.
Primers should be basepairs long.

15. More about Tm
For the primers to anneal to the target DNA, the annealing temperature must be below the Tm of the primers.
Annealing reactions are typically carried out about 5º below the Tm.
If the annealing temperature is too low the primer will mis-anneal to sequences which aren’t perfectly complementary.
If the annealing temperature is too high, the primer will not anneal to the target DNA.
Two primers designed for a PCR experiment should have very similar Tm’s. The Tm should be within 5º of each other, but the closer the Tm’s the better

16. Primer design in ARB Select (NOT mark) your species of interest
Problem: only allows one species to be marke
Choose Probes | Design Primers

17. L & R positions: specifies start positions & ranges for searching (position field in alignment window)
Primer distance: min/max range between primers
Temperature: melting temperature based on 4GC + 2AT

18. Tutorial 6 objectives:
Understand the steps necessary to design probes and primers
Design a probe
Determine if your probe has mismatches, and where the mismatches are located
Determine if your probe is specific to your target sequence by searching public databases
Design a set of sequencing primers