Download presentation
Presentation is loading. Please wait.
1
DNA Technology & Genomics
Started in 1970s The transfer of specific genes (segment of DNA) from one species to another.
2
Recombinant DNA DNA in which genes from 2 different sources are linked
ANDi
3
Genetic engineering Direct manipulation of genes for practical purposes
4
Biotechnology Manipulation of organisms or their components to perform practical tasks or provide useful products
5
How do we get the gene from species A to species B?
A vector is used to carry the gene into the host nucleus.
6
What are vectors commonly used in GE?
Plasmid (of bacteria) Viruses Artificial chromosomes the first cell with a completely synthetic chromosome was created Shotgun technique (blindly shoots tiny particles coated with the gene into the host cells)
7
Cut, Paste, Copy, Find… Word processing metaphor… cut paste copy find
restriction enzymes paste ligase copy plasmids bacterial transformation is there an easier way?? find ????
8
insert “gene we want” into plasmid... “glue” together
Biotechnology Plasmids used to insert new genes into bacteria cut DNA gene we want like what? …insulin …HGH …lactase cut plasmid DNA Cut DNA? DNA scissors? ligase insert “gene we want” into plasmid... “glue” together recombinant plasmid
9
How can plasmids help us?
A way to get genes into bacteria easily insert new gene into plasmid insert plasmid into bacteria = vector bacteria now expresses new gene bacteria make new protein transformed bacteria gene from other organism recombinant plasmid vector plasmid cut DNA + glue DNA
10
How do we cut DNA? Restriction enzymes restriction endonucleases
discovered in 1960s evolved in bacteria to cut up foreign DNA “restrict” the action of the attacking organism protection against viruses & other bacteria bacteria protect their own DNA by methylation & by not using the base sequences recognized by the enzymes in their own DNA
11
What do you notice about these phrases?
radar racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? go hang a salami I’m a lasagna hog palindromes
12
Restriction enzymes Madam I’m Adam Action of enzyme
cut DNA at specific sequences restriction site symmetrical “palindrome” produces protruding ends sticky ends will bind to any complementary DNA Many different enzymes named after organism they are found in EcoRI, HindIII, BamHI, SmaI CTGAATTCCG GACTTAAGGC CTG|AATTCCG GACTTAA|GGC
13
chromosome want to add gene to
Sticky ends Cut other DNA with same enzymes leave “sticky ends” on both can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA
14
How can bacteria read human DNA? human insulin gene in bacteria
Why mix genes together? Gene produces protein in different organism or different individual human insulin gene in bacteria TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC aa “new” protein from organism ex: human insulin from bacteria bacteria human insulin
15
Copy (& Read) DNA Transformation
insert recombinant plasmid into bacteria grow recombinant bacteria in agar cultures bacteria make lots of copies of plasmid “cloning” the plasmid production of many copies of inserted gene production of “new” protein transformed phenotype DNA RNA protein trait
16
Engineered plasmids Building custom plasmids restriction enzyme sites
antibiotic resistance genes as a selectable marker EcoRI BamHI HindIII restriction sites Selectable marker antibiotic resistance gene on plasmid ampicillin resistance selecting for successful transformation successful uptake of recombinant plasmid How do we know what’s the right combination of genes on a plasmid? Trail and error research work. selectable markers high copy rate convenient restriction sites There are companies that still develop plasmids, patent them & sell them. Biotech companies (ex. New England BioLabs) plasmid ori amp resistance
17
Selection for plasmid uptake
Antibiotic becomes a selecting agent only bacteria with the plasmid will grow on antibiotic (ampicillin) plate only transformed bacteria grow all bacteria grow a a a a a a a a a a a a a a a a a LB plate LB/amp plate cloning
18
How do we know the gene made it onto the plasmid?
Insert in the middle of a gene with a known phenotype If the phenotype of that gene is interrupted then “great success” Example: pUC19 plasmid has the lacZ gene that turns X-Gal blue when expressed Proper insertion = not blue
19
Making lots of copies of DNA
But it would be so much easier if we didn’t have to use bacteria every time…
20
Copy DNA without plasmids? PCR!
Polymerase Chain Reaction method for making many, many copies of a specific segment of DNA Advantages of PCR Only a tiny amount (less than 1 µg, one millionth of a gram) of DNA needs to be present in the starting material. Make copies of very rare DNA. Detect genes of pathogens in infected cells or biological weapons.
21
PCR process It’s copying DNA in a test tube! What do you need?
template strand DNA polymerase enzyme nucleotides ATP, GTP, CTP, TTP primer Thermocycler
22
PCR primers The primers are critical!
need to know a bit of sequence to make proper primers primers can bracket target sequence start with long piece of DNA & copy a specified shorter segment primers define section of DNA to be cloned PCR is an incredibly versatile technique: An important use of PCR now is to “pull out” a piece of DNA sequence, like a gene, from a larger collection of DNA, like the whole cellular genome. You don’t have to go through the process of restriction digest anymore to cut the gene out of the cellular DNA. You can just define the gene with “flanking” primers and get a lot of copies in 40 minutes through PCR. Note: You can also add in a restriction site to the copies of the gene (if one doesn’t exist) by adding them at the end of the original primers. 20-30 cycles 3 steps/cycle 30 sec/step
23
PCR process What do you need to do?
in tube: DNA, DNA polymerase enzyme, primer, nucleotides denature DNA: heat (90°C) DNA to separate strands anneal DNA: cool to hybridize with primers & build DNA (extension) Heating Priming Copying Repeat play DNAi movie
24
The polymerase problem
PCR cycles 3 steps/cycle 30 sec/step The polymerase problem Heat DNA to denature (unwind) it 90°C destroys DNA polymerase have to add new enzyme every cycle almost impractical! Need enzyme that can withstand 90°C… Taq polymerase from hot springs bacteria Thermus aquaticus Taq = Thermus aquaticus (an Archaebactera) Highly thermostable – withstands temperatures up to 95°C for more than 40min. BTW, Taq is patented by Roche and is very expensive. Its usually the largest consumable expense in a genomics lab. I’ve heard stories of blackmarket Taq clones, so scientists could grow up their own bacteria to produce Taq in the lab. It’s like pirated software -- pirated genes!
25
Many uses of restriction enzymes…
Now that we can cut DNA with restriction enzymes… we can cut up DNA from different people… or different organisms… and compare it why? forensics medical diagnostics paternity evolutionary relationships and more…
26
Can’t we just add those little marshmallows?
Comparing cut up DNA How do we compare DNA fragments? separate fragments by size How do we separate DNA fragments? run it through a gelatin agarose made from algae gel electrophoresis DNA jello?? Can’t we just add those little marshmallows?
27
“swimming through Jello”
Gel electrophoresis A method of separating DNA in a gelatin-like material using an electrical field DNA is negatively charged when it’s in an electrical field it moves toward the positive side DNA – + “swimming through Jello”
28
“swimming through Jello”
Gel electrophoresis DNA moves in an electrical field… so how does that help you compare DNA fragments? size of DNA fragment affects how far it travels small pieces travel farther large pieces travel slower & lag behind DNA – + “swimming through Jello”
29
fragments of DNA separate out based on size
Running a gel cut DNA with restriction enzymes 1 2 3 Stain DNA ethidium bromide binds to DNA fluoresces under UV light
30
Uses: Evolutionary relationships
Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – 1 3 2 4 5 1 2 3 4 5 DNA +
31
Uses: Medical diagnostic
Comparing normal allele to disease allele chromosome with normal allele 1 chromosome with disease-causing allele 2 allele 1 allele 2 – DNA Example: test for Huntington’s disease +
32
Uses: Forensics Comparing DNA sample from crime scene with suspects & victim suspects crime scene sample S1 S2 S3 V – DNA +
33
DNA fingerprints Comparing blood samples on defendant’s clothing to determine if it belongs to victim DNA fingerprinting comparing DNA banding pattern between different individuals ~unique patterns
34
Differences at the DNA level
Why is each person’s DNA pattern different? sections of “junk” DNA doesn’t code for proteins made up of repeated patterns CAT, GCC, and others each person may have different number of repeats many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA
35
DNA patterns for DNA fingerprints
Allele 1 GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA repeats cut sites Cut the DNA GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTT CGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA 1 2 3 – DNA + allele 1
36
Differences between people
Allele 1 cut sites cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA Allele 2: more repeats GCTTGTAACGGCCTCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA 1 2 3 DNA fingerprint – DNA + allele 1 allele 2
37
Restriction fragment analysis
Restriction fragment length polymorphisms (RFLPs) Each individuals DNA has a unique sequence with specific restriction sites causing different fragment sizes & different band pattern DNA Fingerprinting
38
Polymorphisms in populations
Differences between individuals at the DNA level many differences accumulate in “junk” DNA restriction enzyme cutting sites 2 bands - + single base-pair change 1 band - + sequence duplication 2 different bands - +
39
RFLP / electrophoresis use in forensics
1st case successfully using DNA evidence 1987 rape case convicting Tommie Lee Andrews “standard” semen sample from rapist blood sample from suspect “standard” How can you compare DNA from blood & from semen? RBC? “standard” semen sample from rapist blood sample from suspect “standard”
40
Electrophoresis use in forensics
Evidence from murder trial Do you think suspect is guilty? blood sample 1 from crime scene blood sample 2 from crime scene blood sample 3 from crime scene “standard” blood sample from suspect OJ Simpson blood sample from victim 1 N Brown blood sample from victim 2 R Goldman “standard”
41
Uses: Paternity Who’s the father? – Mom F1 F2 child DNA +
42
Finding your gene of interest
DNA hybridization find sequence of DNA using a labeled probe short, single stranded DNA molecule complementary to part of gene of interest labeled with radioactive P32 or fluorescent dye heat treat DNA in gel unwinds (denatures) strands wash gel with probe probe hybridizes with denatured DNA G A T C labeled probe genomic DNA C T A G T C A T C
43
Finding the Gene of Interest
Southern blot technique Fragments spread apart by electrophoresis Gel blotted with nitrocellulose, DNA transfers to sheet Radioactive probe poured onto nitrocellulose sheet Only fragments with proper gene hybridize with probe
44
Southern blot IDing one gene Southern blot illustration
Edwin Southern Southern blotting Northern blot: RNA on filter & DNA probe measures gene expression because grabbing mRNA from cell -- only expressed genes Western blot: protein on filter labeled directly gel of genomic DNA Southern blot IDing one gene Southern blot illustration
45
Human Genome Project Begun in 1990, the U.S. Human Genome Project is a 13-year effort coordinated by the Department of Energy and the National Institutes of Health. Goals: identify all the approximately 30,000 genes in human DNA, determine the sequences of the 3 billion chemical base pairs that make up human DNA, store this information in databases, improve tools for data analysis, transfer related technologies to the private sector, and address the ethical, legal, and social issues (ELSI) that may arise from the project. Human Genome Project Video
46
Why spend over $4 billion to sequence the genome of humans and others
Why spend over $4 billion to sequence the genome of humans and others? What have we learned? The human genome contains 3 billion chemical nucleotide bases. The average gene consists of 3000 bases, but sizes vary greatly, with the largest known human gene being dystrophin at 2.4 million bases. The functions are unknown for more than 50% of discovered genes. The human genome sequence is almost (99.9%) exactly the same in all people. About 2% of the genome encodes instructions for the synthesis of proteins.
47
Chromosome 1 (the largest human chromosome) has the most genes (2968), and the Y chromosome has the fewest (231). Genes have been pinpointed and particular sequences in those genes associated with numerous diseases and disorders including breast cancer, muscle disease, deafness, and blindness. Scientists have identified about 3 million locations where single-base DNA differences occur in humans. This information promises to revolutionize the processes of finding DNA sequences associated with such common diseases as cardiovascular disease, diabetes, arthritis, and cancers.
48
DNA technology is reshaping medicine and the pharmaceutical industry
Diagnosis of Diseases Use of PCR and labeled nucleic acid probes can be used to track down certain pathogens. For example, because the sequence of HIV DNA is known, PCR can be used to amplify, and thus detect, HIV DNA in blood or tissue samples. Hybridization analysis makes it possible to detect abnormal allelic forms of genes present in DNA samples
49
Use PCR to amplify identified disease regions
Diagnosis of Diseases Use PCR to amplify identified disease regions Analyze region with restriction enzymes and gel Sickle cell Anemia
50
cDNA (copy DNA) libraries
Collection of only the coding sequences of expressed genes extract mRNA from cells reverse transcriptase RNA DNA from retroviruses clone into plasmid Applications need edited DNA for expression in bacteria human insulin Could you imagine how much that first insulin clone was worth to Genentech? One little piece of DNA in a plasmid worth billions! It put them on the map & built a multi-billion dollar biotech company.
51
Gene Therapy involves inserting a copy of the healthy gene and getting expression into cells that have defective versions. What are the problems? Why has this been elusive? Gene therapy movie
52
DNA technology offers forensic, environmental, and agricultural applications.
DNA fingerprints from a murder case. As revealed by RFLP analysis, DNA from bloodstains on the defendant’s clothes matches the DNA fingerprint of the victim but differs from the DNA fingerprint of the defendant.
53
Environmental Uses of DNA Technology
The coal-eating bacteria appear as purple, eating yellow bits of hydrocarbon. Scientists have come up with a clever way to remove sulfur, heavy metals and other bad stuff found in coal, possibly paving the way for far cleaner power plants fueled by this abundant natural resource.
54
Agricultural Uses of DNA Technology
“Pharm” animals are transgenic organisms whose genomes carry genes from another species. These sheep produce proteins in their milk that inhibit an enzyme that contributes to lung damage in cystic fibrosis patients
55
"Golden" rice contrasted with ordinary rice
"Golden" rice contrasted with ordinary rice. Beta-carotene in the golden rice kernels in this photograph is responsible for both their color and their increased nutritional value. The genes that give the plant its ability to make this vitamin inside its kernels come from daffodils and a bacterium. The vector was the Ti plasmid of Agrobacterium fascians.
56
DNA technology raises important safety and ethical questions
Genetically Modified food is controversial What’s the Issue?
Similar presentations
