Download presentation
Presentation is loading. Please wait.
Published byShakira Graff Modified over 10 years ago
1
Neutral Theory of Molecular Evolution most base substitutions are selectively neutral drift dominates evolution at the molecular level Under drift, rate of fixation should be steady through time because drift is the result of chance alone (can happen any time) predicts steady change through time = molecular clock ATGGTCAAGCTTACCATGATGCTCAAGCTTACCATGATGGTCAAGCTTACCATGATGGTCAAGATTACCATGATGGTCAAGATTACCTTGATGGTCAAGATTACCATGATGGTCAAGATTACCATC
2
Challenging the neutral theory Are most mutations neutral? How does a mutation affects the genes function? silent site (synonymous) mutation – neutral no effect on fitness – should drift ATGGTCAAGCTTACCATG met val lys leu thr met ATGGTTAAGCTTACCATG met val lys leu thr met active site
3
Challenging the neutral theory Are most mutations neutral? How does a mutation affects the genes function? silent site (synonymous) mutation – neutral no effect on fitness – should drift replacement site (non-synonymous) mutation – not always neutral how does the mutation affect protein function? deleterious negative (purifying) selection ATGGTCAAGCTTACCATG met val lys leu thr met ATGGTTAAGCTTACCATG met val lys leu thr met ATGGTCAAGCTTACCATG met val lys leu thr met ATGGTCACGCTTACCATG met val thr leu thr met active site
4
Challenging the neutral theory Are most mutations neutral? How does a mutation affects the genes function? silent site (synonymous) mutation – neutral no effect on fitness – should drift replacement site (non-synonymous) mutation – not always neutral how does the mutation affect protein function? minimal effect drift ATGGTCAAGCTTACCATG met val lys leu thr met ATGGTTAAGCTTACCATG met val lys leu thr met ATGGTCAAGCTTACCATG met val lys leu thr met ATGGTCACGCTTACCATG met val thr leu thr met active site
5
Challenging the neutral theory Are most mutations neutral? How does a mutation affects the genes function? silent site (synonymous) mutation – neutral no effect on fitness – should drift replacement site (non-synonymous) mutation – not always neutral how does the mutation affect protein function? beneficial effect positive selection ATGGTCAAGCTTACCATG met val lys leu thr met ATGGTTAAGCTTACCATG met val lys leu thr met ATGGTCAAGCTTACCATG met val lys leu thr met ATGGTCACGCTTACCATG met val thr leu thr met active site
6
Where are substitutions (i.e., mutations that have become fixed) found? What does the neutral theory predict? Substitutions equally common at silent sites and replacement sites What do you predict if negative selection is common? More substitutions at silent sites What do you predict if positive selection is common? More substitutions at replacement sites Studies have detected positive selection in genes that code for proteins involved in fertilization and disease resistance. Why would new variations be valuable for these proteins??? Testing the neutral theory
7
Speciation speciation – formation of new species How does speciation occur? classic hypothesis – allopatric speciation other hypotheses for how speciation can occur How do mutation, migration, selection, drift and non-random mating affect genetic divergence? allopatry – living in different areas
8
Revising the modern synthesis Is evolution always gradual? Eldredge and Gould, 1972, Punctuated Equilibrium How important is genetic drift relative to natural selection? Kimura, 1968, Neutral Theory Is speciation always slow? Does speciation only occur in isolated populations? Evolutionary biology since the modern synthesis LECTURE 12
9
Allopatric speciation original hypothesis for how speciation occurs 3 steps: (1) isolation (geographic) allopatry – living in different areas geographic isolation species range population A population B
10
Allopatric speciation original hypothesis for how speciation occurs 3 steps: (1) isolation (geographic) (2) divergence (mainly by drift) allopatry – living in different areas geographic isolation population A population B divergence
11
Allopatric speciation original hypothesis for how speciation occurs 3 steps: (1) isolation (geographic) (2) divergence (mainly by drift) (3) reproductive isolation (in secondary contact) allopatry – living in different areas population A population B divergence secondary contact gene flow x x x x x x hybrids unfit x x x x x x x x x x x x x x x x x x reproductive isolation
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.