1. Genomic DNA, Genes, Chromatin
Dr. Nabil Bashir

2. Genomic DNA, Genes, Chromatin
a). Genetic dogma
b). forces that affect DNA double helical stability
c). Complexity of chromosomal DNA
i). DNA denaturation
ii). Repetitive DNA and Alu sequences
iii). Genome size and complexity of genomic DNA
d). Gene structure
i). Introns and exons
ii). Properties of the human genome
iii). Mutations caused by Alu sequences
e). Chromosome structure - packaging of genomic DNA
i). Nucleosomes
ii). Histones
iii). Nucleofilament structure

3. DNA, Genes, Chromatin Learning Objectives
Know what is meant by Genetic dogma
Understand the nature of the forces contributing to the stability of the DNA double helix
Understand the process of DNA denaturation and the relationship between melting temperature and the base composition of DNA
know what repetitive sequences are and how they are arranged in the human genome
Understand the mechanism by which Alu sequences have affected the LDL receptor gene
recognize basic gene structure.
Know the basic characteristics of human nuclear and mitochondrial DNA
Understand basic chromosome structure and how DNA is packaged into chromosomes

4. THE FLOW OF GENETIC INFORMATION2 3
DNA
RNA
PROTEIN 1
DNA
Genetic diseases occur because of mutations in DNA. Many of these mutations affect the repair of other mutations that occur during DNA replication or at other times, which in turn affect the flow of genetic information from DNA to RNA (transcription and processing) and from RNA to protein synthesis (translation). Many of these mutations also affect the structures of the resulting proteins, affecting their functions.
1. REPLICATION (DNA SYNTHESIS)
2. TRANSCRIPTION (RNA SYNTHESIS)
3. TRANSLATION (PROTEIN SYNTHESIS)

5. 5-Methylcytosine (5mC).
A common base modification in DNA results from the methylation of cytosine, giving rise to 5-methylcytosine (5mC).
5mC is highly mutagenic.
(5mC) residues are often clustered near the promoters of genes in so-called "CpG islands.“
The problem that arises from these methylations is that subsequent deamination of a 5mC results in the production of thymine, which is not foreign to DNA. As such, 5'-mCG-3' sites (or mCpG sites) are "hot-spots" for mutation, and when mutated are a common cause of cancer.

6. Structure

7. Structure

8. Structure
One Strand of DNA

9. Structure
Introduction

10. Structure
Introduction

11. DNA Structure

12. DNA Forms

13. Forces affecting the stability of the DNA double helix
hydrophobic interactions - stabilize
- hydrophobic inside and hydrophilic outside
stacking interactions - stabilize
- relatively weak but additive van der Waals forces
hydrogen bonding - stabilize
- relatively weak but additive and facilitates stacking
electrostatic interactions - destabilize
- contributed primarily by the (negative) phosphates
- affect intrastrand and interstrand interactions
- repulsion can be neutralized with positive charges
(e.g., positively charged Na+ ions or proteins)
Three types of forces contribute to maintaining the stability of the DNA double helix: 1) hydrophobic interactions, 2) stacking interactions, and 3) hydrogen bonding. The base pairs in the interior of the DNA molecule create a hydrophobic environment, with the negatively charged phosphates along the backbone being exposed to the solvent. Thus, in an aqueous environment, the double-stranded structure is stabilized by the hydrophobic interior. Reagents that solubilize the DNA bases (e.g., methanol) destabilize the double helix. Stacking interactions and hydrogen bonding interactions are relatively weak but additive. Reagents that disrupt hydrogen bonding [e.g., formamide, urea, and solutions with very low pH (pH <2.3) or very high pH (pH >10)] destabilize the double helix.
Electrostatic replusion by negatively charged phosphates along the DNA backbone destabilize the double helix. For example, if the phosphates are left unshielded, as when DNA is dissolved in distilled water, the DNA strands will separate at room temperature. Neutralizing these negative charges by the addition of NaCl (which contributes positively charged sodium ions) to the DNA solution will prevent strand separation. In the cell, the phosphates also interact with positively charged (magnesium, potassium, or sodium) ions and with positively charged (basic) proteins.

14. Stacking interactions
Charge repulsion
This slide shows base stacking and charge repulsion in the DNA double helix.
Charge repulsion

15. Denaturation of DNA Strand separation and formation of single-stranded
random coils
Double-stranded DNA
Extremes in pH or
high temperature
A-T rich regions
denature first
The forces stabilizing the DNA double helix can be overcome by heating the DNA in solution or by treating it with very high or very low pH (low pH will also damage the DNA, whereas high pH will simply separate the polynucleotide chains). When the strands of DNA separate, the DNA is said to be denatured (when high temperature is used to denature DNA, the DNA is said to be melted). Because some of the forces stabilizing the DNA double helix are contributed by base pairing interactions, and because A-T base pairs have only two hydrogen bonds in contrast to G-C base pairs which have three hydrogen bonds, regions of the DNA duplex that are A-T rich will denature first. Once denaturation has begun, there is a cooperative unwinding of the double helix that ultimately results in complete strand separation.
Cooperative unwinding
of the DNA strands

16. Electron micrograph of partially melted DNA
Double-stranded, G-C rich
DNA has not yet melted
A-T rich region of DNA
has melted into a
single-stranded bubble
This slide shows an electron micrograph tracing of a DNA molecule that is only partially melted. The thicker regions are double-stranded and probably more G-C rich. The A-T rich regions are more prone to denaturation, and as seen here, form single-stranded "bubbles."
A-T rich regions melt first, followed by G-C rich regions

17. Hyperchromicity Absorbance maximum for single-stranded DNA Absorbance
double-stranded DNA
Absorbance
When a solution of double-stranded DNA is placed in a spectrophotometer cuvette and the absorbance of the DNA is determined across the electromagnetic spectrum, it characteristically shows an absorbance maximum at 260 nm (in the UV region of the spectrum). If the same DNA solution is melted, the absorbance at 260 nm increases approximately 40%. This property is termed "hyperchromicity." The hyperchromic shift is due to the fact that unstacked bases absorb more light than stacked bases.
220
260
300
The absorbance at 260 nm of a DNA solution increases
when the double helix is melted into single strands.

18. 100 50 70 90
Temperature oC
Percent hyperchromicity
DNA melting curve
Tm is the temperature at the midpoint of the transition
Hyperchromicity can be used to follow the denaturation of DNA as a function of increasing temperature. As the temperature of a DNA solution gradually rises above 50 degrees C, the A-T regions will melt first giving rise to an increase in the UV absorbance. As the temperature increases further, more of the DNA will become single-stranded, further increasing the UV absorbance, until the DNA is fully denatured above 90 degrees C. The temperature at the mid-point of the melting curve is termed "melting temperature" and is abbreviated Tm. The Tm for a DNA depends on its average G+C content: the higher the G+C content, the higher the Tm. Note: G+C content, G-C content, and GC content are equivalent terms.

19. Tm is dependent on the G-C content of the DNA
E. coli DNA is
50% G-C
Percent hyperchromicity 50
This slide shows the dependence of Tm on average G+C content of three different DNAs. Under the conditions used in this experiment, E. coli DNA which has an average G+C content of about 50%, melted with a Tm of 69 degrees C. The curve on the left represents a DNA with a lower G+C content and the curve on the right represents a DNA with a higher G+C content. Tm is dependent on the ionic strength of the solution. At a fixed ionic strength there is a linear relation between Tm and G+C content. 60 70 80
Temperature oC
Average base composition (G-C content) can be
determined from the melting temperature of DNA

20. Type of DNA % of Genome Features
Single-copy (unique) ~75% Includes most genes 1
Repetitive
Interspersed ~15% Interspersed throughout genome between
and within genes; includes Alu sequences 2
Satellite (tandem) ~10% Highly repeated, low complexity sequences
usually located in centromeres
and telomeres
2 Alu sequences are
about 300 bp in length
and are repeated about
300,000 times in the
genome. They can be
found adjacent to or
within genes in introns
or nontranslated regions.
1 Some genes are repeated a few times to thousands-fold and thus would be in
the repetitive DNA fraction
The human genome consists of three populations : Most of the genes in the human genome are in the single-copy fraction. As shown in the next slide, repeated sequences can be of two types: those that are interspersed throughout the genome or those that are tandemly repeated satellite DNAs. Among the interspersed repetitive sequences are so-called "Alu" sequences, which are about 300 base pairs in length and are repeated about 300,000 times in the genome. They can be found adjacent to or within genes, and as illustrated later, their presence can sometimes lead to the occasional disruption of genes. The interspersed repetitive sequences also include VNTRs (variable numbers of tandem repeats), which are comprised of short repeated sequences of only a few base-pairs, but of variable lengths. They, too, are interspersed throughout the genome, and are quite useful as landmarks for mapping genes because they are highly polymorphic (they differ in length or number of repeats from individual to individual).

21. Classes of repetitive DNA
Interspersed (dispersed) repeats (e.g., Alu sequences)
GCTGAGG
GCTGAGG
GCTGAGG
Tandem repeats (e.g., microsatellites)
Interspersed repeats are sequences that are repeated many times and scattered throughout the genome. In contrast, tandem repeats are sequences that are repeated many times adjacent to each other. The latter are usually found in the centromeres and telomeres of chromosomes (the sequence above TTAGGG comprises human teleomeric DNA – see last slide of this series).
TTAGGGTTAGGGTTAGGGTTAGGG

22. Gene structure promoter region
exons (filled and unfilled boxed regions) +1
introns (between exons)
transcribed region
This slide shows the structure of a typical human gene and its corresponding messenger RNA (mRNA). Most genes in the human genome are called "split genes" because they are composed of "exons" separated by "introns." The exons are the regions of genes that encode information that ends up in mRNA. The transcribed region of a gene (double-ended arrow) starts at the +1 nucleotide at the 5' end of the first exon and includes all of the exons and introns (initiation of transcription is regulated by the promoter region of a gene, which is upstream of the +1 site). RNA processing (the subject of a another lecture) then removes the intron sequences, "splicing" together the exon sequences to produce the mature mRNA. The translated region of the mRNA (the region that encodes the protein) is indicated in blue. Note that there are untranslated regions at the 5' and 3‘ ends of mRNAs that are encoded by exon sequence but are not directly translated.
mRNA structure 5’ 3’
translated region

23. The (exon-intron-exon)n structure of various genes
introns can be very long, while exons are usually relatively short.
histone
total = 400 bp; exon = 400 bp
b-globin
total = 1,660 bp; exons = 990 bp
HGPRT
(HPRT)
This figure shows examples of the wide variety of gene structures seen in the human genome. Some (very few) genes do not have introns. One example is the histone genes, which encode the small DNA-binding proteins, histones H1, H2A, H2B, H3, and H4. Shown here is a histone gene that is only 400 base pairs (bp) in length and is composed of only one exon. The beta-globin gene has three exons and two introns. The hypoxanthine-guanine phosphoribosyl transferase (HGPRT or HPRT) gene has nine exons and is over 100-times larger than the histone gene, yet has an mRNA that is only about 3-times larger than the histone mRNA (total exon length is 1,263 bp). This is due to the fact that introns can be very long, while exons are usually relatively short. An extreme example of this is the factor VIII gene which has numerous exons (the blue boxes and blue vertical lines).
total = 42,830 bp; exons = 1263 bp
factor VIII
total = ~186,000 bp; exons = ~9,000 bp

24. Human Genome Project
Knowing the complete sequence of the human genome will:
allow medical researchers to more easily find disease-causing genes.
understand how differences in our DNA sequences from individual to individual may affect our predisposition to diseases and our ability to metabolize drugs.

25. Properties of the human genome
Nuclear genome
the haploid human genome has ~3 X 109 bp of DNA
single-copy DNA comprises ~75% of the human genome
the human genome contains ~20,000 to 25,000 genes
most genes are single-copy in the haploid genome
genes are composed of from 1 to >75 exons
genes vary in length from <100 to >2,300,000 bp
Alu sequences are present throughout the genome
Mitochondrial genome
circular genome of ~17,000 bp
contains <40 genes

26. Alu sequences can be “mutagenic”
Familial hypercholesterolemia
autosomal dominant
LDL receptor deficiency
The rather common (~1 in 500) autosomal dominant disease, familial hypercholesterolemia (FH), is caused by mutations in the LDL (low density lipoprotein) receptor gene (for more information about FH, look at pages of Thompson & Thompson and at Case 9). Plasma LDL, which carries circulating cholesterol, is cleared from the serum by binding to the LDL receptor on liver cells and is internalized. Normal plasma cholesterol levels average below 200 mg/dl. Individuals who have one defective LDL receptor gene (heterozygous) have approximately double this amount, and those with two defective genes (homozygous) have approximately four times this amount. Heterozygous individuals are predisposed to cardiovascular disease, with males having a 50% risk of myocardial infarction by age 50. There are many ways that the LDL receptor gene has been mutated rendering it inactive or abnormal. As shown in the next figure, one mechanism has involved Alu sequences.
From Nussbaum, R.L. et al. "Thompson & Thompson Genetics in Medicine," 6th edition (Revised Reprint), Saunders, 2004.

27. X LDL receptor gene Alu repeats present within introns 4 5 6
Alu repeats in exons
unequal
crossing over 4 5 6
Alu
Alu X
Here you see the structure of the LDL receptor gene (which has 18 exons). Six Alu sequences are present within three of the introns and two of the exons. Because of the close proximity of the two Alu repeats located within introns 4 and 5, unequal crossing over can occur during meiosis. Crossing over (the topic of a future lecture) requires homologous sequences, which base pair with each other during the process of meiosis. The homologous sequences can be provided by the Alu repeats, which can cause an out-of-register misalignment and subsequent crossing over deleting exon 5 from one of the two products of crossing over. This exon 5 in-frame deletion can be inherited and is currently a cause of FH. This deletion affects the LDL binding region of the receptor. Thus, while Alu sequences have no known function in our genomes, there are a lot of them scattered throughout our genomes, within and around genes, and they can be quite disruptive.
Alu
Alu 4 5 6
one product has a
deleted exon 5
(the other product is not shown)
Alu 4 6

28. EM of chromatin shows presence of nucleosomes as “beads on a string”
Chromatin structure
This high power electron micrograph shows the detailed structure of chromosome threads following a gentle preparation technique that involves removal of loosely bound chromosomal proteins while preserving the more tightly bound DNA-binding proteins. The appearance of a "beads on a string" structure is due to regularly spaced nucleosomes (see next slide). "Chromatin" is the biochemical term for DNA-protein complexes that are isolated from eukaryotic chromosomes.
EM of chromatin shows presence of
nucleosomes as “beads on a string”

29. Nucleosome core (left) 146 bp DNA; 1 3/4 turns of DNA
Nucleosome structure
Nucleosome core (left)
146 bp DNA; 1 3/4 turns of DNA
DNA is negatively supercoiled
two each: H2A, H2B, H3, H4 (histone octomer)
Nucleosome (right)
~200 bp DNA; 2 turns of DNA plus spacer
also includes H1 histone
Each nucleosome is composed of a core (left) consisting of two each of the histones, H2A, H2B, H3, and H4, around which the DNA winds 1 3/4 times. The DNA undergoes negative supercoiling as a consequence of being wound around the core histones. Histones are positively charged proteins and thus interact with the negatively charged phosphates along the backbone of the DNA double helix. While the core has 146 bp of DNA, the nucleosome proper (right) has approximately 200 bp of DNA and also includes one histone H1 monomer lying on the outside of the structure. Nucleosomes are regularly spaced along eukaryotic chromosomal DNA every ~200 bp, giving rise to the "beads on a string" structure.

30. arginine or lysine rich: positively charged
Histones (H1, H2A, H2B, H3, H4)
small proteins
arginine or lysine rich: positively charged
interact with negatively charged DNA
can be extensively modified - modifications in
general make them less positively charged
Phosphorylation
Poly(ADP) ribosylation
Methylation
Acetylation
Hypoacetylation
by histone deacetylase (facilitated by Rb)
“tight” nucleosomes
assoc with transcriptional repression
Hyperacetylation
by histone acetylase (facilitated by TFs)
“loose” nucleosomes
assoc with transcriptional activation
Histones are small, positively charged proteins that can be extensively modified posttranslationally, in general to make them less positively charged. Histone deacetylases (HDACs) are associated with transcriptional repression because they make histones better able to bind DNA, thus making DNA less accessible to the transcription machinery. Histone deacetylases are recruited to the chromosome by transcriptional repressors such as the retinoblastoma (Rb) protein (the subject of another lecture). Histone acetylases are recruited to chromosomes by transcription factors (TFs). Histone acetylases reduce the positive charges on histones, causing them to loosen their grip on the DNA to allow transcription factors to bind.

31. Nucleofilament Structure
The orderly packaging of DNA in the cell is essential for the process of DNA replication, as well as for the process of transcription.
Packaging of DNA into nucleosomes is only the first step, foreshortening chromosomal
DNA needs to be packaged in higher-order structures first into closely packed arrays of nucleosomes called nucleofilaments, which are then coiled into thicker and thicker filaments.

34. HIGHLIGHTS
1. A common base modification in DNA results from the methylation of cytosine, giving rise to 5-methylcytosine (5mC).
2. 5mC is highly mutagenic. It is believed that this methylation functions to regulate gene expression because 5-methylcytosine (5mC) residues are often clustered near the promoters of genes in so-called "CpG islands.“
3. The problem that arises from these methylations is that subsequent deamination of a 5mC results in the production of thymine, which is not foreign to DNA. As such, 5'-mCG-3' sites (or mCpG sites) are "hot-spots" for mutation, and when mutated are a common cause of cancer.

35. 4. Three types of forces contribute to maintaining the stability of the DNA double helix: 1) hydrophobic interactions, 2) stacking interactions, and 3) hydrogen bonding. The base pairs in the interior of the DNA molecule create a hydrophobic environment, with the negatively charged phosphates along the backbone being exposed to the solvent. Thus, in an aqueous environment, the double-stranded structure is stabilized by the hydrophobic interior. Reagents that solubilize the DNA bases (e.g., methanol) destabilize the double helix. Stacking interactions and hydrogen bonding interactions are relatively weak but additive. Reagents that disrupt hydrogen bonding [e.g., formamide, urea, and solutions with very low pH (pH <2.3) or very high pH (pH >10)] destabilize the double helix.
5. Electrostatic replusion by negatively charged phosphates along the DNA backbone destabilize the double helix. For example, if the phosphates are left unshielded, as when DNA is dissolved in distilled water, the DNA strands will separate at room temperature. Neutralizing these negative charges by the addition of NaCl (which contributes positively charged sodium ions) to the DNA solution will prevent strand separation. In the cell, the phosphates also interact with positively charged (magnesium, potassium, or sodium) ions and with positively charged (basic) proteins.

36. Types of human DNA
6. The human genome consists of three populations of DNA: the fast and intermediate fractions make up about 10% and 15% of the genome, respectively, and the slow fraction makes up about 75% of the genome. Most of the genes in the human genome are in the single-copy fraction. As shown in the next slide, repeated sequences can be of two types: those that are interspersed throughout the genome or those that are tandemly repeated satellite DNAs. Among the interspersed repetitive sequences are so-called "Alu" sequences, which are about 300 base pairs in length and are repeated about 300,000 times in the genome. They can be found adjacent to or within genes, and as illustrated later, their presence can sometimes lead to the occasional disruption of genes.

37. Gene Structure
7. Most genes in the human genome are called "split genes" because they are composed of "exons" separated by "introns."
8. The exons are the regions of genes that encode information that ends up in mRNA.
9. The transcribed region of a gene (double-ended arrow) starts at the +1 nucleotide at the 5' end of the first exon and includes all of the exons and introns (initiation of transcription is regulated by the promoter region of a gene, which is upstream of the +1 site).
10. RNA processing (the subject of a another lecture) then removes the intron sequences, "splicing" together the exon sequences to produce the mature mRNA.
11. The translated region of the mRNA (the region that encodes the protein) is indicated in blue. Note that there are untranslated regions at the 5' and 3‘ ends of mRNAs that are encoded by exon sequence but are not directly translated.

38. The (exon-intron-exon)n structure of various genes introns can be very long, while exons are usually relatively short.
12. wide variety of gene structures seen in the human genome. Some (very few) genes do not have introns. One example is the histone genes, which encode the small DNA-binding proteins, histones H1, H2A, H2B, H3, and H4.
13. histone gene that is only 400 base pairs (bp) in length and is composed of only one exon.
14. The beta-globin gene has three exons and two introns.
15. The hypoxanthine-guanine phosphoribosyl transferase (HGPRT or HPRT) gene has nine exons and is over 100-times larger than the histone gene, yet has an mRNA that is only about 3-times larger than the histone mRNA (total exon length is 1,263 bp).

39. Alu sequences can be “mutagenic”
16. familial hypercholesterolemia (FH): autosomal dominant disease,, is caused by mutations in the LDL (low density lipoprotein) receptor gene .
17.Plasma LDL, which carries circulating cholesterol, is cleared from the serum by binding to the LDL receptor on liver cells and is internalized.
18. Normal plasma cholesterol levels average below 200 mg/dl. Individuals who have one defective LDL receptor gene (heterozygous) have approximately double this amount, and those with two defective genes (homozygous) have approximately four times this amount.
19. Heterozygous individuals are predisposed to cardiovascular disease, with males having a 50% risk of myocardial infarction by age 50.
20. There are many ways that the LDL receptor gene has been mutated rendering it inactive or abnormal. As shown in the next figure, one mechanism has involved Alu sequences.

40. Chromatin Structure
21. The appearance of a "beads on a string" structure is due to regularly spaced nucleosomes (see next slide).
22. "Chromatin" is the biochemical term for DNA-protein complexes that are isolated from eukaryotic chromosomes.

41. LDL Receptor Gene
23. Here you see the structure of the LDL receptor gene (which has 18 exons). Six Alu sequences are present within three of the introns and two of the exons. Because of the close proximity of the two Alu repeats located within introns 4 and 5, unequal crossing over can occur during meiosis. Crossing over (the topic of a future lecture) requires homologous sequences, which base pair with each other during the process of meiosis. The homologous sequences can be provided by the Alu repeats, which can cause an out-of-register misalignment and subsequent crossing over deleting exon 5 from one of the two products of crossing over. This exon 5 in-frame deletion can be inherited and is currently a cause of FH. This deletion affects the LDL binding region of the receptor. Thus, while Alu sequences have no known function in our genomes, there are a lot of them scattered throughout our genomes, within and around genes, and they can be quite disruptive.

42. Nucleosome Structure
24. Each nucleosome is composed of a core (left) consisting of two each of the histones, H2A, H2B, H3, and H4, around which the DNA winds 1 3/4 times. The DNA undergoes negative supercoiling as a consequence of being wound around the core histones. Histones are positively charged proteins and thus interact with the negatively charged phosphates along the backbone of the DNA double helix. While the core has 146 bp of DNA, the nucleosome proper (right) has approximately 200 bp of DNA and also includes one histone H1 monomer lying on the outside of the structure. Nucleosomes are regularly spaced along eukaryotic chromosomal DNA every ~200 bp, giving rise to the "beads on a string" structure.

43. Histones (H1, H2A, H2B, H3, H4)
25. Histones are small, positively charged proteins that can be extensively modified posttranslationally, in general to make them less positively charged.
26. Histone deacetylases (HDACs) are associated with transcriptional repression because they make histones better able to bind DNA, thus making DNA less accessible to the transcription machinery. Histone deacetylases are recruited to the chromosome by transcriptional repressors such as the retinoblastoma (Rb) protein (the subject of another lecture).
27. Histone acetylases are recruited to chromosomes by transcription factors (TFs). Histone acetylases reduce the positive charges on histones, causing them to loosen their grip on the DNA to allow transcription factors to bind.

44. Nucleofilament Structure
28. The orderly packaging of DNA in the cell is essential for the process of DNA replication, as well as for the process of transcription.
29. Packaging of DNA into nucleosomes is only the first step, foreshortening chromosomal
30. DNA needs to be packaged in higher-order structures first into closely packed arrays of nucleosomes called nucleofilaments, which are then coiled into thicker and thicker filaments.