Presentation is loading. Please wait.

Presentation is loading. Please wait.

Daily Warm-Up Monday, December 9th

Similar presentations


Presentation on theme: "Daily Warm-Up Monday, December 9th"— Presentation transcript:

1 Daily Warm-Up Monday, December 9th
Describe DNA. What is the monomer of DNA? What are the bases? What do each pair with? Homework: -Read 12.2 Turn in: -Planaria conclusion

2 DNA Replication What stage of cell cycle is DNA replicated?

3 DNA replication Creation of new DNA molecule Semi-conservative

4 Enzymes Helicase- unwinds DNA
DNA polymerase- adds nucleotides to template strand Ligase- seals the DNA together

5 Other terms Template strand- strand that copy of DNA is made from
Leading strand- strand that is copied continuously Lagging strand- copied discontinuously Okazaki fragments- stretches of DNA on the lagging strand that will be linked together by ligase

6 Okazaki fragments DNA is always replicated in a 5’ 3’ direction

7

8 ATTGGCCTTAATTCCGGATCG


Download ppt "Daily Warm-Up Monday, December 9th"

Similar presentations


Ads by Google