1. Daily Warm-Up Monday, December 9th
Describe DNA. What is the monomer of DNA? What are the bases? What do each pair with?
Homework:
-Read 12.2
Turn in:
-Planaria conclusion

2. DNA Replication
What stage of cell cycle is DNA replicated?

3. DNA replication
Creation of new DNA molecule
Semi-conservative

4. Enzymes Helicase- unwinds DNA
DNA polymerase- adds nucleotides to template strand
Ligase- seals the DNA together

5. Other terms Template strand- strand that copy of DNA is made from
Leading strand- strand that is copied continuously
Lagging strand- copied discontinuously
Okazaki fragments- stretches of DNA on the lagging strand that will be linked together by ligase

6. Okazaki fragments
DNA is always replicated in a
5’ 3’ direction

8. ATTGGCCTTAATTCCGGATCG