Presentation is loading. Please wait.

Presentation is loading. Please wait.

Long terminal repeats of porcine endogenous retroviruses in Sus scrofa

Similar presentations


Presentation on theme: "Long terminal repeats of porcine endogenous retroviruses in Sus scrofa"— Presentation transcript:

1 Long terminal repeats of porcine endogenous retroviruses in Sus scrofa
Yun-Ji Kim1 Jae-Won Huh1, Byung-Wook Cho2, Dae-Soo Kim3, Hong-Seok Ha1, Ja-Rang Lee1, Kung Ahn1, and Heui-Soo Kim1,3 1 Division of Biological Sciences, College of Natural Sciences, Pusan National University, Busan , Republic of Korea 2 Department of Animal Science, College of Life Sciences, Pusan National University,Miryang , Republic of Korea 3 PBBRC, Interdisciplinary Research Program of Bioinformatics, College of Natural Sciences, Pusan National University, Busan , Republic of Korea Abstract Introduction Materials & Methods Using PCR, sequencing, and bioinformatic approaches with the genomic DNAs of Korean pigs (domestic, wild, and hybrid with Yorkshire), twelve solitary PERV long terminal repeat elements were identified and analyzed. Structure analysis of the LTR elements indicated that they have different repeat sequences in the U3 region. The PERV-A6-KWP1 and –KWP2 elements bear seven and eight 39 bp repeats, respectively. The R region of the PERV LTR elements was highly conserved in pig and mouse genomes, suggesting that they seem to have originated from a common exogenous viral element, and then independently evolved throughout the course of mammalian evolution. Genomic DNAs & cDNA PCR & RT-PCR Bioinformatics KWP,KDP,KDP×KYP QIAEX II gel extraction kit(Qiagen) High Pure plasmid isolation kit BLAST,MEGA2 PCR Electrophoresis Gel purification Transformation1 Transformation2 Ligation Inoculation Plasmid DNA Isolation Gene Cloning Results & Discussion 5'-CATTTCTACTGAGCCACAACAG-3' PERV-X10-AS CT009542 1369 5'-CCTGAAAACTGCACTCTCCTCT-3' PERV-X10-S 5'-AGCAGGTTTAGGTTCACAGCA-3' PERV-X9-AS CT955978 930 5'-AGGAGTGGGTTCCAGGTTTC-3' PERV-X9-S 5'-CTTGCATACTTGGGCTTGTG-3' PERV-A8-AS CT827949 961 5'-GGAGGGTAGGACACAGTGGA-3' PERV-A8-S 5'-TGCTTTCACAAGTATTCATCCA-3' PERV-A7-AS CT797462 904 5'-CTCAGTGGGTTGGGGTTCT-3' PERV-A7-S 5'-CCCCAAATCACTCACGAGAA-3' PERV-A6-AS AC138167 899 5'-CGTATCCAATCACCTGCATC-3' PERV-A6-S 5'-TATTTCCATCCCTGAACCCA-3' PERV-A5-AS CT737311 748 5'-AAGCCAATCTCCCTTCTTCC-3' PERV-A5-S Acession no. Location PCR product size (bp) Sequences (5'-3') Primer Table 1. PCR primers used for amplification of PERV LTR element in Korean pigs (A) Conserved region PERV-A5 U3 R U5 Group1 Tandem repeated region PERV-A (Repbase) PERV-B PERV-A6 PERV-A7 (KYP, KDP, KWP) PERV-A8 LTR-IS Mouse S1 S5 S7 S2 S6 (KWP1) (KWP2) Group1a S3 Group2 PERV-X9 PERV-X10 S8 S9 Deleted region: GCCAGTAA S4 Fig. 1. Schematic representation of various PERV LTR elements (A) and consensus sequences of figured boxes (B). Open boxes indicate the conserved regions, and figured boxes indicate the specific sequences. Closed boxes indicate the different consensus sequences. Different boxes in tandem repeated region indicate the repeat number of tandem repeat sequences. Numbers indicate the specific position in individual LTR sequences. The underlined nucleotide sequences indicate the binding site for the transcription factor, NF-Y. The structures of solitary PERV LTR elements (PERV-A5, -A6, -A7, -A8, -X9, -X10) are derived from Korean pigs, KYP-hybrid of Korean domestic pig × Yorkshire, KDP-Korean domestic pig, and KWP-Korean wild pig (see also Table 2). KWP1 and KWP2 indicate the allele difference in the same individual. Group 2 is PERV-C LTR element and Group 1a is defined by the different copy number of tandem repeated sequences in our sequencing analysis. In the case of the mouse LTR-IS element, only the conserved region (open gray box) has high homology with PERV LTR elements...……………………………………………………………………. References Sus scrofa X10 CT (722 bp) PERV-X10-GenBamk Hybrid (KDPⅹYorkshire) X9 AB (701 bp) PERV-X9-KYP CT (701 bp) PERV-X9-GenBamk Korean wild pig A8 AB (609 bp) PERV-A8-KWP Korean domestic pig AB (609 bp) PERV-A8-KDP AB (609 bp) PERV-A8-KYP CT (609 bp) PERV-A8-GenBamk A7 AB (694 bp) PERV-A7-KWP AB (694 bp) PERV-A7-KDP AB (694 bp) PERV-A7-KYP CT (694 bp) PERV-A7-GenBamk A6 AB (794 bp) PERV-A6-KWP2 AB (833 bp) PERV-A6-KWP1 AC (762 bp) PERV-A6-GenBamk A5 AB (628 bp) PERV-A5-KWP AB (628 bp) PERV-A5-KDP AB (628 bp) PERV-A5-KYP CT (589 bp) PERV-A5-GenBamk Sources LTR Types Acession no. (LTR size) Clone Table 2. Clone information of PERV LTR elements in Korean pigs Denner J, Specke V, Thiesen U, Karlas A, Kurth R (2003) Genetic alteration of the long terminal repeat of an ecotropic porcine endogenous retrovirus during passage in human cells. Virology 314: 2. Akiyoshi DE, Denaro M, Zhu S, Greenstein JL, Banerjee P, Fishman JA (1998) Identification of a full-length cDNA for an endogenous retrovirus of miniature swine. J Virol 72: : GAGCCCTAACTCCAGCTTCCTAAA : CTCTGTATGAACTAGGTGAAAGGACGTAAAATAGGCCCTTGAATGCGTG : TGAGATAACAGGGAAAAGGGTT S1 : TATTTTAAAATGATTGGT (Original 18bp repeat) S5 : CCACGGAGCGCGGGCTCTCGA (Original 21bp repeat) S7 : TGTAGGAAAAATGATTGGT (Subtype of 18bp repeat) S3 : TGTTTTAAAACGATTGGT (Subtype of 18bp repeat) S2 : TGTTTTAAAATGATTGGT (Subtype of 18bp repeat) S6 : CCACGGAGCGCA (Subtype of 21bp repeat) S8 : AGTTTTGAATTGACTGGTTTGTGA (24bp, C type) S9 : TTGTAAAAGCGCGGGCTTG (19bp, C type) S4 : TTAAAATTAATTGGT (Subtype of 18bp repeat) : ATAAAA (TATA signal) : cap site (B) Genome Information Lab


Download ppt "Long terminal repeats of porcine endogenous retroviruses in Sus scrofa"

Similar presentations


Ads by Google