Presentation is loading. Please wait.

Presentation is loading. Please wait.

I will stamp your Idea Journal -Protein Function.

Published byChristal Cain Modified over 6 years ago

Similar presentations

Presentation on theme: "I will stamp your Idea Journal -Protein Function."— Presentation transcript:

1 I will stamp your Idea Journal -Protein Function.
Opening Activity: May 7, 2018 I will stamp your Idea Journal -Protein Function. Grab a small piece of paper from front table. Write your name & seating preferences: Who do you work well with? Anyone you don’t work well together? Place in the front tub when finished. 4. Pick up TWO handouts from front – tape in. I can… How are genes related to functional and non-functional proteins. Homework: Review source, which items are missing – get them in!!

2 Example: Tanning

3 DNA (gene) protein traits
Information flow in cells: Use a model to illustrate how DNA determines the structure of proteins which, in turn, determine an organism’s traits. DNA (gene) protein traits

4 Human Skin Color – No Albinism
Colorless Molecule Melanin Pigment Molecule Functional Tyrosinase Protein When the protein is a functional shape, we see a particular trait  The skin has pigment

5 colorless (white) molecule
Melanin Pigment molecule Tyrosinase Protein Colorless molecule Melanin pigment molecule Enzyme Q

6 What is different about the two proteins?
Non-functional protein Functional Protein What do you think might cause this difference?

7 if the ACTIVE SITE is missing the ACTION cannot occur
colorless (white) molecule Melanin Pigment molecule Non Functional Tyrosinase Protein Colorless molecule Melanin pigment molecule if the ACTIVE SITE is missing the ACTION cannot occur Non Functional Tyrosinase Protein

8 Where is this happening?
Biosynthesis occurs inside of cells Remember 1st semester? Therefore, proteins live and work inside of cells I am the cell! Melanin pigment molecule I am the nucleus! Colorless molecule Functional Protein

9 Genes are specific sections of DNA that code for specific proteins
Cell membrane Gene Nucleus Chromosome Genes are specific sections of DNA that code for specific proteins Different versions of genes are called alleles Functional Gene Non-Functional Gene These are different alleles

10 Find your handout labeled: Modeling proteins in cells.
MID Activity: May 7, 2018 Find your handout labeled: Modeling proteins in cells. Read the directions on handout and draw what you would see in the nucleus of each cell for bioflowers (top portion) Draw what you would see in the cytoplasm for each cell. I can… How are genes related to functional and non-functional proteins. Homework: Review source, which items are missing – get them in!!

11 “Roundbuds”

12 Roundbud colors White molecule Red Pigment molecule Enzyme Q

13 Cell with gene for non-functional enzyme Q
Cell of RED flower Cell of WHITE flower Non-functional gene Functional gene Cell with gene for non-functional enzyme Q Cell with gene for functional enzyme Q

14 TSR Receptor – sticks to bitter molecules causing bitter taste
Receptor protein example: PTC receptors Functional receptors in tongue cells bond to the bitterness molecule and send “bitter signals” to the brain Non-functional receptors cannot bond the bitterness molecule and no signal is sent

15 Other Structural Proteins
Hemoglobin is an important protein in red blood cells that, when functional, attaches to and carries Oxygen through the bloodstream. When hemoglobin is non- functional, it can no longer carry Oxygen effectively Collagen is a protein involved in movement in animals. When collagen is functional in C. elegans they move smoothly - like a wave. When collagen is non-functional in C. elegans they can no longer turn smoothly and instead they roll!

16 Bioflowers A colorless starting molecule is converted by enzyme A to blue pigment. Next, enzyme B converts the blue pigment to red pigment. Diagram of the pathway. (include a key) Give an explanation for a blue flower.

17 Pigment Network for the Imaginary Bioflower
Blue Flower Red Flower Where is the variation in these flowers? Blue and Red Flowers (Color)

18 pathway Molecule cartoons Colorless (white) molecule
Blue pigment molecule Red pigment molecule Enzyme A Enzyme B Molecule cartoons

19 Draw the enzymes and molecules present in the cells of each type of bioflower below.
nucleus Enzyme A Enzyme B pathway

20 Draw the enzymes and molecules present in the cells of each type of bioflower below.
nucleus Enzyme A Enzyme B pathway

21 Draw the enzymes and molecules present in the cells of each type of bioflower below.
nucleus Enzyme A Enzyme B pathway

22

23 Exit Ticket A population of bears in British Columbia is famous for their white fur. Genetically they are identical to black bears, but the gene that normally turns a colorless precursor into black fur is non-functional. Draw a biomolecular model that shows a skin cell of these white bears.

24 Review the Metabolic Pathway at your table:
Opening Activity: May 10, 2018 Review the Metabolic Pathway at your table: How many different genes are responsible for coat color in retrievers? Draw a nucleus for a black Labrador. Draw a nucleus for a chocolate (brown) Labrador. 2. Where do the chemical reaction in the pathway take place? I can… Explain the relationship between DNA, proteins, traits. Homework: Review source, which items are missing – get them in!!

25 “Coat Color in Labrador Retrievers”
Cocoa Midnight

26 “Coat Color in Labrador Retrievers”
Darby Nellie

27 Metabolic Pathway for Coat Color (Labrador Retrievers)
Yellow and/or Red pigments tyrosinase Tyrosine Dopaquinone Enzyme X TRP-2 Brown pigment TRP-1 Black pigment

28 DNA structure- Chromosomes
Chromosomes = long pieces of DNA

29 Cereal Protein You will work by yourself.
You will use the instructions in the nucleus to build a protein back in the classroom. You MUST leave the DNA (instructions) in the nucleus. You MUST make notes about the DNA on a separate piece of paper (no pictures!) You MUST do any building in the cytoplasm (at your table) Post the slightly difference sequences in different places in the classroom. Have some students use one of the sequences and the other students use the other sequence.

30 Hold up your model Does everyone look the same?

31 Information flow in cells
DNA protein traits Fruit Loops on a pipe cleaner instructions traits

32 Chromosome structure- genes
Regions of chromosomes called genes determine which proteins can be made in the cell Traits result from which proteins are made Human chromosome # 7 Contains about 1,800 genes Contains over 150 million nucleotides Zooming into the genome

33 ACGGCTATAGCAGTCATGAT ATCTTGACTGCTATAGCCGT
A gene is a section of a chromosome that tells an organism how to make a specific protein Chromosome ACGGCTATAGCAGTCATGAT ATCTTGACTGCTATAGCCGT ATAACAGGCGACTTACGGCTATAGCAGTCATGATCATCTACAGAGATCATCTACTTAAGCATTACAGA TCTGTAATGCTTAAGTAGATGATCTCTGTAGATGATCTTGACTGCTATAGCCGTAAGTCGCCTGTTAT Gene

34 ACGGCTATAGCAGTCATGAT ATCTTGACTGCTATAGCCGT ACGGCTATAGCCGTCATGAT
A gene is a section of a chromosome that tells an organism how to make a specific protein Chromosome ATAACAGGCGACTTACGGCTATAGCAGTCATGATCATCTACAGAGATCATCTACTTAAGCATTACAGA TCTGTAATGCTTAAGTAGATGATCTCTGTAGATGATCTTGACTGCTATAGCCGTAAGTCGCCTGTTAT Gene ACGGCTATAGCAGTCATGAT ATCTTGACTGCTATAGCCGT ACGGCTATAGCCGTCATGAT ATCTTGACGGCTATAGCCGT What’s missing from this? The fruit loops. Next slide – something showing the fruit loops representing amino acids. Version 1 of the Gene FUNCTIONAL Version 2 of the gene NON-FUNCTIONAL

35 ACGGCTATAGCAGTCATGAT ATCTTGACTGCTATAGCCGT
Based on the Fruit Loops Activity, what is missing from this flow chart? ACGGCTATAGCAGTCATGAT ATCTTGACTGCTATAGCCGT What’s missing from this? The fruit loops (amino acids) Next slide – something showing the fruit loops representing amino acids. Version 1 of the Gene FUNCTIONAL ACGGCTATAGCCGTCATGAT ATCTTGACGGCTATAGCCGT Version 2 of the gene NON-FUNCTIONAL

36 ACGGCTATAGCAGTCATGAT ATCTTGACTGCTATAGCCGT
Version 1 of the gene FUNCTIONAL ACGGCTATAGCCGTCATGAT ATCTTGACGGCTATAGCCGT Version 2 of the gene What’s missing from this? The fruit loops (amino acids) Next slide – something showing the fruit loops representing amino acids. NON-FUNCTIONAL

37 Exit Ticket What did the list of colors on the wall represent?
What did the fruit loops represent? If we were to continue this analogy, what would happen next to the fruit loops on the string?

38 DNA vs. RNA DNA RNA Sugar = deoxyribose Sugar = ribose
Double-stranded molecule Single-stranded molecule Thymine bonds with adenine Uracil instead of thymine

39 RNA vs. DNA

40 Pick up Protein Synthesis Reading at front table:
Opening Activity: May 11, 2018 Pick up Protein Synthesis Reading at front table: Highlight Vocabulary Words – define 3 List 3 different types of proteins and describe their role. Summarize the steps to make a protein. 2. Look at microscope slides #1 and #2 around the room. Make a sketch in your journal of each. I can… Explain the relationship between DNA, proteins, traits. Homework: Review source, which items are missing – get them in!!

41 Protein Synthesis 1. Movies
2. Let’s Practice!

42 DNA  Protein Practice Directions for using a codon wheel:
1st DNA base  Find the letter in the center of the wheel. 2nd DNA base  Find the letter in the second layer of the wheel. 3rd DNA base  Find the letter in the outer layer of the wheel

43 Protein Synthesis Computer Animations
(short and simple) (real time-molecular visualization)

44 Protein Synthesis Scenario
Tape handout into journal. Complete scenarios with Ian and answer questions.

45 Hemoglobin

46 How can cells have the same DNA but different sets of proteins?
Gene expression refers to the genes being transcribed and translated into proteins in a cell In a given cell, some genes are “on” while other genes are “off”. Different cells express different sets of genes.

47 How are Genes Regulated?
Coding region – the part of the DNA with specific information to build a protein Regulatory region – sequence of DNA that can be bound by a protein to regulate gene expression Regulatory protein that binds to to in order to turn transcription on or off Indicate where the regulatory DNA is compared to the coding sequence. Regulatory Protein Regulatory Region Coding Sequence

48 How are Genes Regulated?
Coding region – the part of the DNA with specific information to build a protein Regulatory region – sequence of DNA that can be bound by a protein to regulate gene expression Regulatory protein that binds to to in order to turn transcription on or off Indicate where the regulatory DNA is compared to the coding sequence.

49 Today’s Work Regulatory Protein Regulatory DNA Sequence AGATCAGC TCTAGTCG CGACTCAC GCTGAGTG TAGACTCC ATCTGAGG GAGCTACG CTCGATGC ATGCCTGC TACGGACG Complete the Gene Regulation Activity in your journal for a STAMP. Finish other journal work. Regulatory proteins in cell CELL #1 Which proteins are made? gene C is transcribed, RNA is translated, protein C is made Protein C GAGCTACG CTCGATGC Coding sequence gene A Coding sequence gene B Coding sequence gene C ATGCCTGC TACGGACG AGATCAGC TCTAGTCG

Download ppt "I will stamp your Idea Journal -Protein Function."

Similar presentations

Introduction to DNA Structure.

Introduction to DNA Structure.
After today’s lesson you will be able to transcribe a DNA fragment into an RNA fragment and translate the RNA into a polypeptide.

After today’s lesson you will be able to transcribe a DNA fragment into an RNA fragment and translate the RNA into a polypeptide.
What makes you look like your parents? Your parents passed down their DNA to you. What’s carried in your DNA that gives you your traits & characteristics?

What makes you look like your parents? Your parents passed down their DNA to you. What’s carried in your DNA that gives you your traits & characteristics?
Inquiry: How is DNA used to store and transmit cell information?

Inquiry: How is DNA used to store and transmit cell information?
Unit 7- Cell Cycle, DNA, and Protein Synthesis

Unit 7- Cell Cycle, DNA, and Protein Synthesis
NOTES: Chapter 13 - RNA & Protein Synthesis

NOTES: Chapter 13 - RNA & Protein Synthesis
Transcription and Translation. The Central Dogma of Molecular Biology: DNA --> RNA --> Protein Protein synthesis requires two steps: transcription and.

Transcription and Translation. The Central Dogma of Molecular Biology: DNA --> RNA --> Protein Protein synthesis requires two steps: transcription and.
Lecture #3 Transcription Unit 4: Molecular Genetics.

Lecture #3 Transcription Unit 4: Molecular Genetics.
DNA, RNA, and Proteins Section 3 Section 3: RNA and Gene Expression Preview Bellringer Key Ideas An Overview of Gene Expression RNA: A Major Player Transcription:

DNA, RNA, and Proteins Section 3 Section 3: RNA and Gene Expression Preview Bellringer Key Ideas An Overview of Gene Expression RNA: A Major Player Transcription:
RNA Structure and Protein Synthesis Chapter 10, pg. 208-221.

RNA Structure and Protein Synthesis Chapter 10, pg
DNA & Protein Synthesis Chapter 4 Section 3. Vocabulary 1. DNA 2. nucleotide 3. nitrogen bases 4. base pairing 5. double helix 6. DNA replication 7. gene.

DNA & Protein Synthesis Chapter 4 Section 3. Vocabulary 1. DNA 2. nucleotide 3. nitrogen bases 4. base pairing 5. double helix 6. DNA replication 7. gene.
DNA, RNA, and Protein Synthesis. Function of DNA as “master” program DNA codes for the primary structure of a protein which impacts the tertiary structure,

DNA, RNA, and Protein Synthesis. Function of DNA as “master” program DNA codes for the primary structure of a protein which impacts the tertiary structure,
LG 4 DNA and Protein Synthesis Ribonucleic Acid RNA – Steps in Protein Synthesis Transcription – Translation – Functions of Proteins Structural – Signals.

LG 4 DNA and Protein Synthesis Ribonucleic Acid RNA – Steps in Protein Synthesis Transcription – Translation – Functions of Proteins Structural – Signals.
YouTube - The Gene Scene. The Structure of RNA There are three main differences between RNA and DNA. 1. The sugar in RNA is ribose instead of deoxyribose.

YouTube - "The Gene Scene". The Structure of RNA There are three main differences between RNA and DNA. 1. The sugar in RNA is ribose instead of deoxyribose.
Introduction to Gene Expression Chapter 8 Sections 4 & 5.

Introduction to Gene Expression Chapter 8 Sections 4 & 5.
Modern Genetics How information is passed from parents to offspring.

Modern Genetics How information is passed from parents to offspring.
Gene Expression DNA, RNA, and Protein Synthesis. Gene Expression Genes contain messages that determine traits. The process of expressing those genes includes.

Gene Expression DNA, RNA, and Protein Synthesis. Gene Expression Genes contain messages that determine traits. The process of expressing those genes includes.
Transcription & Translation. Objectives: Relate the concept of the gene to the sequences of nucleotides in DNA Sequence the steps involved in protein.

Transcription & Translation. Objectives: Relate the concept of the gene to the sequences of nucleotides in DNA Sequence the steps involved in protein.
March 17, 2015 I can… How are genes related to functional and non-functional enzymes. Homework: TEST RETAKE – by appt. Protein Quiz 3/24 1.In Lab #19 we.

March 17, 2015 I can… How are genes related to functional and non-functional enzymes. Homework: TEST RETAKE – by appt. Protein Quiz 3/24 1.In Lab #19 we.
Topic 25 – RNA and protein synthesis

Topic 25 – RNA and protein synthesis

Similar presentations

Ads by Google