1. Sequences and their Properties

2. Nucleotides
DNA
A, T, G, C
RNA
A, U, G, C

3. Annealing Two opposing forces affect annealing
Nucleic acids can base pair with their reverse complement sequence
Two opposing forces affect annealing
Hydrogen bonds favours annealing
Phosphate groups favours denaturation

4. Annealing-Melting Point (Tm)
The Tm is the temperature at which 50% of the nucleic acid molecules are in a single stranded state (or double stranded)
The Tm is a function of:
Percentage G:C
Ionic composition of the environment
The percentage of complementarity
Estimate of Tm for oligos
=2(#A:T) + 4(#G:C)

5. Tm Vs percentage G:C % Double stranded Temperature (C) (38%) G+C (52%) 50
100
(38%) G+C
(52%)
(58%)
(66%)
% Double stranded
Temperature (C)

6. Tm Vs Conc. of Positive Ions
(0.1M NaCl) 50
100
(0.2M NaCl)
(0.5M NaCl)
% Double stranded
Temperature (C)

7. Tm Vs percentage of Complementarity
(25%) 50
100
(50%)
(100%)
% Double stranded
Temperature (C)

8. Stringency
Percentage of complementarity required to allow the formation of stable duplexes
The Tm influences the stringency conditions required to allow annealing
A high stringency requires a high level of complementarity
GATCCGGTTATTA vs GATCCGGTTATTA
CTAGGCCAATAAT CTTGGACGATAAT

9. Parameters that Influence Stringency
 [salt] = High stringency
 Temperature = High stringency
 [salt] = ?
 Temperature = ?

10. Hybridization Stringency

11. Genetics and Biometrics

12. Definitions Locus Gene
The position of a coding or non coding genetic element
Gene
All the nucleotide elements required for the expression of a transcript
Promoter, ORF, introns, exons, etc.

13. Genetic Definitions (Cont’d)
Allele
Version of a genetic element at a given locus
Everyone necessarily has two alleles for each genomic locus
The two alleles may be the same
Homozygotes
The two alleles may be different
Heterozygote
A population of individuals may have multiple alleles of a genomic locus

14. Genetic Definitions (Cont’d)
Genotype:
Nucleic acid sequence responsable for the phenotype
Physical detection by molecular techniques
Phenotype:
Trait that can be distinguished resulting from a genotype
Several different genotypes may have the same phenotype

15. The Differences Between individuals of the same sex
<0.5%
Between humans and chimpanzes
<2%

16. Molecular Markers Characteristics of the nucleotide sequence
The phenotype often corressponds to a specific genotype
Restriction polymorphisms (RFLP)
Length polymorphisms (VNTR)
Variable number of tandem repeats
Single nucleotide polymorphisms (SNP)

17. Length Polymorphisms - RFLP
Based on the presence or absence of a restriction site at a given poistion
Ex. The enzyme EcoR1 recognizes and cleaves the sequence:
GAATTC
A single base mutation abolishes the site
GAGTTC

18. Detection of Genomic RFLP1 2
Polymorphism A B E
A+B * E
Genome 1
Genome 2
2 possible phenotypes
2 alleles can be distinguished
Several possible genotypes 18

19. Detection of RFLP by PCR

20. Length Polymorphisms Minisatellites and Microsatellites:
Sequences repeated in tandem
Highly variable number of repetitions between individuals; thus several alleles
Length polymorphisms
Molecular phenotype=Genotype  
Minisatellites
Low distribution throughout the genome Mostly found within telomeres
Microsatellites:
High distribution throughout the genome
VNTR

21. Length polymorphisms - VNTRs
The number of repetitions
= different lengths
= different alleles
= different genotypes
= different molecular phenotypes

22. Length Polymorphisms - VNTR
DNA Region where tandem copies of di-, tri- or tetra repeated units are located
Examples:
Dinucleotide repeat GTGTGTGTGTGT……
Trinucléotide repeat ACGACGACGACG……
Tetranucléotide repeat TATCTATCTATC……

23. VNTR (Cont’d) Highly variable number of repetitions individuals
Thus several alleles within a population CA
Allele 1
Allele 2
Allele 3
Different fragment lengths would be generated by a digestion at the indicated positions

24. Detection of VNTR by PCR
AGCTGCTTAATGCTGCTGCTGCTGCTGCTGCATAACATTGC
Individual 1
AGCGGCTTAATGCTGCTGCATAACATTGC
Individual 2 1 2
Amplification & gel
separation 24

25. Biometrics

26. VNTR Profile
From whom does the blood come from? 26

27. VNTR Profile
Bob
Luc
Paul
Tom
Marc
Who is Bob’s father? 27

28. Determing number of loci
Determine both extremes
In this case 8 and 13
Dertermine max and min for each extreme
In the case of 8: max 8, min 4
In the case of 13: max 13, min 7
Determine range
7-8 loci
What is maximum number of homozygous loci if number of bands is 13?