Presentation is loading. Please wait.

Presentation is loading. Please wait.

Jeopardy Final Jeopardy $100 $100 $100 $100 $100 $200 $200 $200 $200

Similar presentations


Presentation on theme: "Jeopardy Final Jeopardy $100 $100 $100 $100 $100 $200 $200 $200 $200"— Presentation transcript:

1 Jeopardy Final Jeopardy $100 $100 $100 $100 $100 $200 $200 $200 $200
Dna Discovery Chromosome Structure Central Dogma DNA Structure DNA Replication $100 $100 $100 $100 $100 $200 $200 $200 $200 $200 $300 $300 $300 $300 $300 $400 $400 $400 $400 $400 $500 $500 $500 $500 $500 Final Jeopardy

2 1 - $100 What two scientists created a model of DNA? Watson and Crick

3 1 - $200 Who took the famous photo 51 using x-ray diffraction?
Rosalind Franklin

4 1 - $300 Who identified the molecule that transformed the R strain of bacteria into the S strain? Oswald Avery

5 1 - $400 Who published results of experiments that provided definitive evidence that DNA was the transforming factor? Hershey and Chase

6 1 - $500 Who led the first major experiment that led to the discovery of DNA Frederick Griffith

7 2 - $100 What are the subunits of nucleic acids that consist of a 5 carbon sugar, a phosphate group, and a nitrogenous base. Nucleotides

8 2 - $200 In DNA the amount of cytosine is equal to the amount of______________ Guanine

9 2 - $300 In DNA the amount of adenine is equal to the amount of _______ Thymine

10 2 - $400 Thee twisted ladder shape of Dna is also called what?
A double helix

11 2 - $500 Name the Pyrimidine bases Cytosine and thymine.

12 3 - $100 What type of replication saves half of the original DNA strand Semiconservative replication

13 3 - $200 What enzyme unwinds and unzips DNA DNA helicase

14 3 - $300 What enzyme adds nucleotides to the already existing ones
DNA polymerase

15 3 - $400 Provide the complements to this DNA sequence
ACGTACGATCCATGACAAGTCAGCAGGTACGATTTA TGCATGCTAGGTACTGTTCAGTCGTCCATGCTAAAT

16 3 - $500 What are okazaki fragments
Answers may vary however the phrase lagging strand must be used

17 4 - $100 What is dna attracted to a histone called? Nucleosome

18 4 - $200 What do nucleosomes group up to form? Chromatin fibers

19 4 - $300 In prokaryotes, where is the DNA molecule contained?
In the cytoplasm

20 4 - $400 What does DNA coil around. Histones

21 4 - $500 What kind of charge do the phosphate groups in DNA create
Negative

22 5 - $100 What is the transfer of Dna to mRna Transcription

23 5 - $200 What is thymine replaced by in transcription Uracil

24 5 - $300 Which code is longer mRna or Dna Dna

25 5 - $400 Which is single stranded Dna or Rna RNA

26 5 - $500 Which rna trANSFERS THE AMINO ACIDS TO THE RIBOSOMES TRNA

27 Final Jeopardy Wha is 1=2 apoptosis


Download ppt "Jeopardy Final Jeopardy $100 $100 $100 $100 $100 $200 $200 $200 $200"

Similar presentations


Ads by Google