Presentation is loading. Please wait.

Presentation is loading. Please wait.

Basic Biology Review.

Similar presentations


Presentation on theme: "Basic Biology Review."— Presentation transcript:

1 Basic Biology Review

2 Human Body Organization
Levels 1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic

3 Chemical Level Elements Molecules Compounds Macromolecules Ions H C O
NaCl KCl Ions Na+ K+ Cl- Ca++ Mg++ Molecules O2 CO2 C6H12O6 Macromolecules Proteins amino acids Lipids fatty Acids Carbohydrates monosaccharides Nucleic Acids nucleotides

4 Cellular Level Chromatin

5 Tissue Level Epithelial Tissue Connective Tissue Muscular Tissue
Nervous Tissue

6 Organ Level Gastrointestinal Tract 1. Mouth Accessory Structures
2. Pharynx 3. Esophagus 4. Stomach 5. Small Intestine 6. Large Intestine Accessory Structures 1. Teeth 2. Tongue 3. Salivary Glands 4. Liver 5. Gallbladder 6. Pancreas

7 Organ System Level

8 Organismic Level Darwin sails around the world
and in South America is puzzled by the absence of rabbits. Instead he finds these rabbit-like Patagonian Hares or Mara (Dolichotis patagonum) that are not rabbits but have similar characteristics as rabbits. He postulates that they must have evolved just like rabbits because of their similar environments

9 Animal Cell Chromatin

10 DNA (deoxyribonucleic acid) Bases/Base Pairs Nucleotides 1. 2.
3. Nitrogenous Base Base Pairs: A – T C – G

11 DNA Organization Chromatin organized: DNA Histones
One Duplicated Chromosome

12 Human Chromosomes A Pair of Duplicated Chromosomes
Autosomes Sex Chromosomes 46 individual chromosomes / 23 pairs of chromosomes they are the same - code for same type of trait they are different - code for different version of trait

13 Understanding the Numbers
1 chromosome is 1 large DNA molecule a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG genes per chromosome ~25, ,000 genes per human genome

14 DNA Functions Pass on Genetic Material Replication Protein Synthesis
Mitosis Meiosis Protein Synthesis Transcription Translation

15 Mitosis

16 Replication Making an exact copy of DNA
Occurs just prior to cell division Double helix unwinds DNA polymerase adds bases Two exact copies are made

17 Embryongenesis - Week 1 Blastocyst Inner Cell Mass
(Embryonic Stem Cells) Pluripotent Stem Cells

18 Embryogenesis Week 2 Embryonic Germ Cell Layers: Endoderm Mesoderm
Ectoderm Multipotent Stem Cells

19 Cell Migration Growth Cone

20 Radial Glia Act like scaffolding to assist movement of neurons during
development

21 Guide Posts Intermediate targets that help guide or
direct the growth cone of the migrating cell in the proper direction

22 Chemotropism Target Cell or Tissue
Target tissues or cells can release chemicals that will attract the specific growth cones of migrating cells.

23 Differentiation

24 Schizophrenia Abnormality Hippocampal Pyramidal Cell Disorganization

25 Neurobehavioral Hypothesis
Maternal/Fetal Evidence: extensive maternal bleeding prolonged labor delivery complications low birth weight low head circumference body length:body weight multiparity Anectodal Evidence Dutch births during WWII Season of birth effect higher for winter pregnancies parallel with virus exposure

26 Protein Synthesis Transcription DNA to mRNA Translation
mRNA to Protein

27 From Gene to Protein DNA RNA Protein

28 Genetic Code Codons three base code Code for specific amino acids

29 Point Mutation Spontaneous Mutation Environmental Insult Mutagenesis
Carcinogenesis Mutation is corrected

30 Point Mutation Mutation is not corrected Mutation is corrected

31 Sickle-Cell Anemia Mutation

32 Sickle-Cell Anemia Mutation

33 Two-Hit Hypothesis Born with 2 genes or alleles for any given disease:
one from mom one from dad If one is bad, this increases your chance of getting the disease

34 Cancer in Women

35 Lung Cancer


Download ppt "Basic Biology Review."

Similar presentations


Ads by Google