1. How cells use DNA, part 2: TRANSLATION

2. An overview:
In the process of translation in a cell, the transcribed message of mRNA is translated to a totally different ‘language’, that of protein.
DNA & RNA are ‘written’ in very similar chemicals, but protein is ‘written’ in an entirely different ‘script’: amino acids.
Most commonly, what comes to mind is the process by which we take ideas expressed in one language, & make them intelligible in another language.
Often this means a change of script, from one we don’t understand to another we can read.

3. For Translation we need:
An ‘edited’ or ‘mature’ mRNA
Ribosomes
An unusual molecule, transfer or tRNA
Lots of available Amino Acids

4. The overall goal:
Use the DNA message that was copied out into mRNA to produce a polypeptide or protein.
This is the second part of the CENTRAL DOGMA
It relies on the GENETIC CODE.

5. The tRNA: Acts as a ‘taxi’ for Amino Acids
Single stranded, but folded upon itself into a clover-like shape.
Able to bind to Amino Acids at one end, and to mRNA at the other.
The mRNA binding end has an ANTICODON.
Each Anticodon codes for a different Amino Acid.

6. The tRNA: Amino acids bind at the 3’ end of tRNA.
This requires some ATP energy!
The Anticodon binds to a complementary codon sequence on the mRNA.
i.e. AUG codon = UAC anticodon

7. The Ribosome: Site of translation
Can be free in the cytoplasm, or associated with the R.E.R., Golgi Body, or Nucleolus.
Two Subunits Lg/Sm
Able to bind mRNA
Binds tRNA at one of three sites: E (Exit), P (Peptidyl Aminoacyl) or A (Acetyl Aminoacyl)

8. The Ribosome:
The mRNA binds in the groove between the large & small subunits.
The first tRNA binds to the P Site.
A second tRNA binds to the A Site.
This brings the amino acids on each tRNA close enough to form a peptide bond.
As the ribosome shifts down the mRNA, the first tRNA is bumped into the E site & is released.

9. The Amino Acids: 20 different Amino Acids
All have the same basic structure: central Carbon bound to a Hydrogen, an Amino Group (NH2) and Carboxyl Group (COOH)
The fourth bond Carbon makes is to a variable group, abbreviated ‘R’
Each Amino Acid has a unique ‘R’
Some are nonpolar & hydrophobic (orange), rest are polar/HPhilic
2 are acidic, 3 are basic.

10. The Amino Acids:
During translation, the Amino Acids ‘meet’ at the ribosome
When they are brought close together (on the ribosome), the Amino Group of one reacts with the other’s Carboxyl Group.
In a dehydration synthesis reaction, a peptide bond forms.

11. Initiating Translation:
mRNA binds to the Ribosome
tRNA’s carrying amino acids arrive, binding anticodon to codon
Peptide bond forms between Amino Acids

12. Continuing the chain:
The ribosome now shifts 1 codon, moving the first tRNA into the E Site, the second into the P site, and opening the A site for a new tRNA to bind.

13. Continuing the chain:
Many ribosomes can bind to the same mRNA & translate it simultaneously, amplifying the amount of protein made.

14. Reading the mRNA: Codons in the mRNA are ‘read’ in threes
Each three-base combination represents a specific amino acid, & matches a tRNA anticodon
Some amino acids have only one code; others have several
Thus, the code is redundant.

15. Different forms of the Code:

16. Different forms of the Code:

17. Different forms of the Code:

18. How the code works: TAC AAA GCC TAG GAT ACA ATT
The DNA Sequence:
TAC AAA GCC TAG GAT ACA ATT
Is translated to the mRNA sequence:
AUG UUU CGG AUC CUA UGU UAA
Which in turn encodes the following sequence of amino acids in a polypeptide:
MET—PHE—ARG—ILE—LEU—CYS—(stop)

19. Wrapping things up:
There are three mRNA codons that signal the end of a protein
They are called STOP CODONS: UAA, UAG, UGA
*in DNA, these are ATT, ATC, & ACT.
When it reaches a stop codon, the ribosome releases the mRNA, & translation ends.

21. Try your hand at this: mRNA Sequence: AUGCCUCGCAAAGGUUGCCACGUAUAA
Amino Acid Sequence:
MET PRO ARG LYS GLY CYS HIS VAL Stop