1. Chapter 14 Bioinformatics—the study of a genome
using computer analysis
Genomics—the study of genes of humans
and other organisms
Proteomics—the study of
the proteins of the cell

2. Researchers can monitor expression of specific genes
Cells of a given multicellular organism differ from each other because they express different genes from an identical genome
The most straightforward way to discover which genes are expressed by cells of interest is to identify the mRNAs being made
How? 2

3. Detecting the mRNA in a cell using nucleic acid hybridization
Nucleic “probe” are labeled with fluorescent tags to allow visualization 3

4. Reverse transcriptase–polymerase chain reaction (RT-PCR)
RT-PCR turns sample sets of edited mRNAs into double-stranded DNAs with the corresponding sequences
Relies reverse transcriptase which synthesizes a DNA copy of an mRNA = complementary DNA (cDNA)
Once the cDNA is produced, PCR is used to make many copies of the sequence
This process can be used for genetic disease and cancer detection 4

5. Test tube containing reverse transcriptase and mRNA
Figure
DNA in nucleus 1
Test tube containing reverse transcriptase and mRNA
mRNAs in cytoplasm
Figure Making complementary DNA (cDNA) from eukaryotic genes (step 1) 5

6. Test tube containing reverse transcriptase and mRNA
Figure
DNA in nucleus 1
Test tube containing reverse transcriptase and mRNA
mRNAs in cytoplasm
Reverse transcriptase
Poly-A tail 2
Reverse transcriptase makes the first DNA strand.
mRNA 5
A A A A A A 3 3 T T T T T 5
DNA strand
Primer
Figure Making complementary DNA (cDNA) from eukaryotic genes (step 2) 6

7. Test tube containing reverse transcriptase and mRNA
Figure
DNA in nucleus 1
Test tube containing reverse transcriptase and mRNA
mRNAs in cytoplasm
Reverse transcriptase
Poly-A tail 2
Reverse transcriptase makes the first DNA strand.
mRNA 5
A A A A A A 3 3 T T T T T 5
DNA strand
Primer 3
mRMA is degraded. 5
A A A
A A A 3 3 T T T T T 5
Figure Making complementary DNA (cDNA) from eukaryotic genes (step 3) 7

8. Test tube containing reverse transcriptase and mRNA
Figure
DNA in nucleus 1
Test tube containing reverse transcriptase and mRNA
mRNAs in cytoplasm
Reverse transcriptase
Poly-A tail 2
Reverse transcriptase makes the first DNA strand.
mRNA 5
A A A A A A 3 3 T T T T T 5
DNA strand
Primer 3
mRMA is degraded. 5
A A A
A A A 3 3 T T T T T 5 4
Figure Making complementary DNA (cDNA) from eukaryotic genes (step 4)
DNA polymerase synthesizes the second strand. 5 3 3 5
DNA polymerase 8

9. Test tube containing reverse transcriptase and mRNA
Figure
DNA in nucleus 1
Test tube containing reverse transcriptase and mRNA
mRNAs in cytoplasm
Reverse transcriptase
Poly-A tail 2
Reverse transcriptase makes the first DNA strand.
mRNA 5
A A A A A A 3 3 T T T T T 5
DNA strand
Primer 3
mRMA is degraded. 5
A A A
A A A 3 3 T T T T T 5 4
Figure Making complementary DNA (cDNA) from eukaryotic genes (step 5)
DNA polymerase synthesizes the second strand. 5 3 3 5
DNA polymerase 5
cDNA carries complete coding sequence without introns. 5 3 3 5
cDNA 9

10. DNA Cloning: Making Multiple Copies of a Gene or Other DNA Segment
Many bacteria contain plasmids, small circular DNA molecules that replicate separately from the bacterial chromosome
To clone pieces of DNA, researchers first obtain a bacterial plasmid and insert DNA from another source (“foreign DNA”) into it
The resulting plasmid is called recombinant DNA 10

11. Cell containing Bacterium gene of interest Gene inserted into plasmid
Figure 13.22a
Cell containing
gene of interest
Bacterium 1
Gene inserted
into plasmid
Bacterial
chromosome
Plasmid
DNA of
chromosome
(“foreign” DNA)
Recombinant
DNA (plasmid)
Gene of interest 2
Plasmid put into
bacterial cell
Recombinant
bacterium
Figure 13.22a An overview of gene cloning and some uses of cloned genes (part 1: steps) 3
Host cell grown in culture to
form a clone of cells containing
the “cloned” gene of interest
Gene of
interest
Protein expressed
from gene of interest 11

12. Gene for pest resistance inserted into plants Human growth hormone
Figure 13.22b
Gene of
interest
Protein expressed
from gene of interest
Copies of gene
Protein harvested 4
Basic
research
and various
applications
Gene for pest resistance
inserted into plants
Human growth hormone
treats stunted growth
Figure 13.22b An overview of gene cloning and some uses of cloned genes (part 2: applications)
Gene used to alter bacteria
for cleaning up toxic waste
Protein dissolves blood clots
in heart attack therapy 12

13. In gene cloning, the original plasmid is called a cloning vector
Again the polymerase chain reaction, PCR, can produce many (millions) copies of a specific target segment of DNA 13

14. Using Restriction Enzymes to Make Recombinant DNA
Bacterial restriction enzymes cut DNA molecules at specific DNA sequences called restriction sites
A restriction enzyme usually makes many cuts, yielding restriction fragments 14

15. Figure
Restriction site 5 3
DNA G A A T T C C T T A A G 3 5 1
Restriction enzyme cuts
the sugar-phosphate
backbones. 3 5 5 3 G A A T T C C T T A A G 5 3 3 5
Sticky end
Figure Using a restriction enzyme and DNA ligase to make recombinant DNA (step 1)
The most useful restriction enzymes cleave the DNA in a staggered manner to produce sticky ends 15

16. Sticky ends can bond with complementary sticky ends of other fragments
Figure
Restriction site 5 3
DNA G A A T T C C T T A A G 3 5 1
Restriction enzyme cuts
the sugar-phosphate
backbones. 3 5 5 5 A 3 G A T T C C T T A A G 5 3 3 5
Sticky end 5 2
DNA fragment added
from another molecule
cut by same enzyme.
Base pairing occurs. A A T 3 T C G 3 5
Figure Using a restriction enzyme and DNA ligase to make recombinant DNA (step 2) 5 3 5 3 5 3 G A A T T C G A A T T C C T T A A G C T T A A G 3 5 3 5 3 5
One possible combination
Sticky ends can bond with complementary sticky ends of other fragments
DNA ligase can close the sugar-phosphate backbones of DNA strands 16

17. Restriction enzyme cuts the sugar-phosphate backbones.
Figure
Restriction site 5 3
DNA G A A T T C C T T A A G 3 5 1
Restriction enzyme cuts
the sugar-phosphate
backbones. 3 5 5 3 G A A T T C C T T A A G 5 3 3 5
Sticky end 5 2
DNA fragment added
from another molecule
cut by same enzyme.
Base pairing occurs. A A T 3 T C G 3 5
Figure Using a restriction enzyme and DNA ligase to make recombinant DNA (step 3) 5 3 5 3 5 3 G A A T T C G A A T T C C T T A A G C T T A A G 3 5 3 5 3 5 3
DNA ligase
seals the strands.
One possible combination 5 3 3
Recombinant DNA molecule 5 17

18. DNA fragment obtained by PCR (cut by same restriction
Figure 13.26
Cloning
vector
(bacterial
plasmid)
DNA fragment obtained by
PCR (cut by same restriction
enzyme used on cloning vector)
Mix and ligate
Figure Use of restriction enzymes and PCR in gene cloning
Recombinant DNA plasmid 18

19. The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA
A 3 step cycle  chain reaction to produce an exponentially growing population of identical DNA molecules
The key to PCR is an unusual, heat-stable DNA polymerase called Taq polymerase. 19

20. Technique Target sequence Genomic DNA Denaturation Annealing Cycle 1
Figure 13.25
Technique 5 3
Target sequence
Genomic DNA 3 5 1
Denaturation 5 3 3 5 2
Annealing
Cycle 1
yields 2 molecules
Primers 3
Extension
New
nucleotides
Figure Research method: the polymerase chain reaction (PCR)
Cycle 2
yields 4 molecules
Cycle 3
yields 8 molecules;
2 molecules
(in white boxes)
match target sequence 20

21. To see the fragments produced researchers use gel electrophoresis
This technique separates a mixture of nucleic acid fragments based on length 21

22. (a) Negatively charged DNA molecules will move
Figure 13.24
Mixture of
DNA mol-
ecules of
different
sizes
Power
source
Cathode
Anode
Wells
Gel
(a) Negatively charged DNA molecules will move
toward the positive electrode.
Figure Gel electrophoresis
Restriction fragments
(b) Shorter molecules are impeded less than
longer ones, so they move faster through the gel. 22

24. Steps Involved in the Making of a Transgenic Organism
Isolate and cut out a desired gene using restriction enzymes.
Use restriction enzymes to cut a plasmid and add the desired gene.
Use DNA ligase to seal the new gene.
Use vector to deliver new rDNA to bacterial or other cells.
Allow bacterial cells to replicate and produce desired product.

25. Technology to Determine “Relatedness”
Basic Local Alignment Search Tool
BLAST finds regions of similarity between biological sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance
To determine homologous sequences in other organisms
Sequence TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATCAGATGCGACCGCAAC CACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTCAACCACCACCACGGTGTCGTCTTCCCCGAA CGCGTCCCGGTCAGCCAGCCTCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCG ACGGTGCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA