1. Darwin & Natural Selection
Adapted from Mr. Gray & Bristol University

2. Basic Scientific Terms Review
Hypothesis: is an educated guess, based on observations . It's a prediction of cause and effect.
Theory:
Summarizes a hypothesis/hypotheses
Supported with repeated testing
Valid as long as there is no evidence to dispute it
Explains how and why something happens
Example: Theory of Plate Tectonics
Law:
Generalizes a LOT of observations
Tells you what IS going to happen
Example: Law of Gravitation

3. Directions Manager: read ?’s
Can a theory become a law? Explain.
What’s wrong with this statement – I have a theory that students get more write ups after the holidays.

4. Evolution
Evolution: The process of change over time; one species gives rise to another & “tree” grows!
All living things share a common ancestor.
We can draw a “family” tree of life to show how every species is related.

5. Learning Manager – read ?
Besides cell phones, what other non-biological items have evolved?

6. Charles Darwin Father of Evolution
Proposed the theory of evolution, change over time
Made observations on a 5-year trip around the world on the ship the HMS Beagle
Wrote a book “Origin of the Species” that documented his observations
Survival of the Fittest idea came from this book

8. Darwin’s Finches

9. Check out their feet!!!

11. On Task Manager – read ?
Charles Darwin noticed all the different looks of the same species. How might different looks affect whether a species goes extinct?

12. Natural Selection
Natural Selection: Organisms that are best adapted to an environment survive and reproduce more than others

13. How Natural Selection Occurs – 4 Ways
Overproduction
Variation
Competition
Selection

14. Overproduction
Each species produces more offspring that can survive

15. Variation
Each individual has a unique combination of inherited traits (DNA)
Adaptation: an inherited trait that increases an organism’s chances of survival
Environments can change which can change the success of an adaptation
Same Parents

16. Adaptation Categories
Camouflage (Blend in and hide)
Mimicry (Act and look like)
Physiological (Poison)
Behavioral (Group behavior)
Remember the organism doesn’t CHOOSE the adaptation! They are born with it or the environment is more supporting of it!

18. Coral Snake (Poisonous)
Milk Snake (Not poisonous)

25. Stick Mantid

26. Flower Mantid

27. What adaptations do you see?

28. What adaptations do you see?

29. Variation
The more variation within a species, the more likely they are to survive
The more variation of types of species in a habitat, the more likely at least some will survive

31. Which community has a better chance of surviving a natural disaster?
Community A
Community B

32. Competition Individuals COMPETE for food, water, space, etc.
Survival of the Fittest – the fittest is most able to survive and reproduce
Not all individuals survive to adulthood

33. Selection
Best adaptations will survive and be able to pass on their traits to their kids
Genotype: your genes/DNA
Ex: Cat’s ear shape
Phenotype: your physical appearance that is influenced by your genes and the environment
The color of the flamingo is based on what they eat (environment)

34. Materials Manager – read ? ‘s
What are the 4 “methods” of natural selection?
Which “method” in your opinion affects humans most?

35. How It Works
Individuals with traits that are not well suited to their environment either die or leave few offspring.
Evolution occurs when good traits build up in a population over many generations and bad traits are eliminated by the death of the individuals.

36. 50 Million Years Ago

39. Today

41. Directions Manager – read ?
Summarize how giraffes evolved.

42. Peppered Moth A
Which moth will the bird catch? B

43. Evidence for Evolution:
Fossil Record
Homologous Body Structures
Vestigial Organs
Embryology
Biochemical Evidence

44. Fossil Record
Fossils provide a record of the history of life on Earth

45. Progression of Organisms
© World Health Org.
en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png
© NASA
origins
bacteria
complex cells
dinosaurs
humans
The fossil record shows a sequence from simple bacteria to
more complex organisms through time and provides the most
compelling evidence for evolution.

46. Transitional Fossils – Ex. Archaeopteryx
Missing link between reptiles and birds

47. Geologic Separation

48. Homologous Body Structures
Body parts that are similar in different species
Related organisms have similar body structures

50. Humans and Gorillas Bone Structure

51. Vestigial Organs
“Leftover” organs (traces of evolution) that serve no purpose currently (did in the past)
Examples appendix, tonsils, tailbone, wisdom teeth

52. Embryology
Embryos of all vertebrates are very similar early on – yes you had gills!

53. The Pharyngeal Pouches will shape parts of the pharynx and upper bronchial segments

54. Biochemistry
DNA with more similar sequences suggest species are more closely related
Humans and chimpanzees share > 98% of identical DNA sequences
HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
Genetic code of chimps and gorillas is almost identical to humans

55. Directions Manager – read ?
What are the 5 types of evidence used for evolution?
What is your opinion about evolution?

56. Thinking outside biology/species – how might the quote above affect you in everyday/real life?

57. Supporting Resources Must Watch—Fantastic Review Simpson Evolution
Must Watch—Fantastic Review
Simpson Evolution