Presentation is loading. Please wait.

Presentation is loading. Please wait.

Visualization of genomic data

Similar presentations


Presentation on theme: "Visualization of genomic data"— Presentation transcript:

1 Visualization of genomic data
16-Nov-18 Genome browsers  Visualization of genomic data

2 16-Nov-18 16-Nov-18 Survey  UCSC browser Ensembl browser Others ? 2

3 UCSC genome browser Basic functionalities used in exercise
16-Nov-18 16-Nov-18 UCSC genome browser Basic functionalities used in exercise  Finding a gene by name by sequence Gene structure Orthologues – i.e. functional homolog in other organisms SNP’s - Single Nucleotide Polymorphisms Several other functionalities Gene Sorter - sort according to expression, homology, in situ images of genes in different tissues Custom tracks – upload your own data 3

4 Visualization of genomic data
16-Nov-18 Genome browsers  Visualization of genomic data

5 Genome browsers Visualization of a gene
16-Nov-18 Genome browsers Visualization of a gene  Flat files / tab files >chr5: ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGC GTCCGCCTTCCCGCTGCCCGCCGGTAAGAGGCCTCCCGAGGCGCCCGCCG AAGACCGCTCCCTCGGCCGCCGCCGCGCGCCCTTCGCGCTGAGCAGTGAC TGTAAGAACCGTTCCCTCCCCGCGGGGGGGCCGCCGGCGGACCCCCTCGC ACCCCCACCCGCAGCCAGCCCCGCACGTACCCCAAGCCAGCCTGATGGCT GTGTGGCCTACCGACCCGTGGGCAAGGGGTGCGGGTGCTGAAGCCCCCAG GGGTGCCTGGCTGCCCACTGCTGCCCGCACGCCTGGCCTGAAAGTGACAC GCGCTGGTTTGCCCAGCACAGAGGGGATGGAATTTTTATGCTGCTCCTTT AGCATTCTGATGAACAAATATCCTCCCCACCAGCACCACCACCTCAGTAA Exon Intron Exon Chr Open Reading Frame (ORF) – from start to stop codon

6 Genome browsers Why graphic Display ?
16-Nov-18 Genome browsers Why graphic Display ?  Why is a graphic display better than Flat files / tab files A graphic display is compact Meta data available i.e. Support information about a gene Experimental evidence like EST Predicted gene structures SNP information Links to many databases In short much data about a gene is gathered is one place and can be viewed easily.

7 Genome browsers Visualization of a gene (Ensembl)
16-Nov-18 Genome browsers Visualization of a gene (Ensembl) 

8 Genome browsers Visualization of a gene (UCSC)
16-Nov-18 Genome browsers Visualization of a gene (UCSC)  Exon Intron UTR

9 Genome browsers  UCSC genome browser http://genome.ucsc.edu/
16-Nov-18 Genome browsers  UCSC genome browser Easy to use Often updates, but not as often as Ensembl upload of personal tracks Ensembl browser Less easy to use Maintained/updated by several people Gbrowser

10 BLAT Blast Like Alignment Tool
16-Nov-18 BLAT Blast Like Alignment Tool BLAT (2002) Very fast searches (MySQL database) Handle introns in RNA/DNA alignments Check that donor/acceptor rules are followed Data for more that 30 genomes (human, mouse, rat…) Exon Intron Exon Splice sites Donor site Acceptor site GT AG

11 16-Nov-18 BLAT genome Browser

12 16-Nov-18 BLAT genome Browser Using a search term or position eg Chr1:10,234-11,567

13 16-Nov-18 BLAT genome Browser

14 16-Nov-18 BLAT genome Browser Using a protein or DNA sequence

15 16-Nov-18 Blat genome Browser

16 BLAT genome Browser ”Details”
16-Nov-18 BLAT genome Browser ”Details” Correct splice site ?

17 Logo Plot Information Content
16-Nov-18 IC = -H(p) + log2(4) = a palog2pa + 2 The Information content is calculated from a multiple sequence alignment. Result is a graphical visualization of sequence conservation where: Total height at a position is the Information Content Height of single letter is proportional to the frequency of that letter Mutiple alignment of 3 protein sequences: Seq1: A L R K P Q R T Seq2: A V R H I L L I Seq3: A I K V H N N T Pos1: I = [1*log2(1)] = log2(20) = 4.32 Pos2: I = [1/3*log2(1/3)+ 1/3*log2(1/3)+ 1/3*log2(1/3)] = 2.73 Pos3: I = [2/3*log2(2/3)+ 1/3*log2(1/3) = 3.38

18 16-Nov-18 Logo Plot Exon

19 BLAT genome Browser ”Details”
16-Nov-18 BLAT genome Browser ”Details” Correct splice site ?

20 BLAT genome Browser ”Details”
16-Nov-18 BLAT genome Browser ”Details” Donor site | Acceptor site exon... . G | GT ...intron ...AG | exon...

21 16-Nov-18 Blat genome Browser

22 BLAT genome Browser ”Browser”
16-Nov-18 BLAT genome Browser ”Browser” Base, Center & Zoom Known genes Predictions RNA EST Expression Conservation

23 16-Nov-18 Genome browsers 

24 16-Nov-18 Genome browsers 

25 BLAT genome Browser Center & zoom
16-Nov-18 BLAT genome Browser Center & zoom

26 BLAT genome Browser Center & zoom
16-Nov-18 BLAT genome Browser Center & zoom Selected number of tracks Forward/reverse direction

27 BLAT genome Browser Sequence Orthologs
16-Nov-18 BLAT genome Browser Sequence Orthologs

28 BLAT genome Browser Sequence Orthologs
16-Nov-18 BLAT genome Browser Sequence Orthologs “klick”

29 BLAT genome Browser Sequence Orthologs
16-Nov-18 BLAT genome Browser Sequence Orthologs

30 BLAT genome Browser Sequence Orthologs
16-Nov-18 BLAT genome Browser Sequence Orthologs

31 BLAT genome Browser Sequence Orthologs
16-Nov-18 BLAT genome Browser Sequence Orthologs

32 16-Nov-18 SNPs

33 Single Nucleotide Polymorphism SNP
SNPs can be located anywere in the genome non synomous (nsSNP) i.e. amino acid is changed (shown below ) Synomous SNP does not affect the the protein V I T P An amino acid is coded by 3 nucleotides Valine (V): GTC Humans are diploid: cells have 2 homologous copies of each chromosome i.e. 2*23 chromosomes. Haploid cells only 23 chromosomes (sex-cells)

34 Diploid organism - most mammals
An example of two homologous copies of ex chromosome 9 within a cell A chromosome from mother A chromosome from father If the red strand is the plus-strand: C;T (or T;C but we write it alphabetical) If the green strand is the minus strand: G;A but we write it as G;A

35 16-Nov-18 SNPs

36 16-Nov-18 SNPs

37 Exercise Basic understanding of the graphics
16-Nov-18 Exercise Basic understanding of the graphics Effect of Single Nucleotide Polymorphisms (SNPs) Finding Orthologue genes Identify chromosomal locus for a gene


Download ppt "Visualization of genomic data"

Similar presentations


Ads by Google