1. Welcome to the world of two Arabidopsis genes:
At4g14770 and At3g22760
At4g14770 and At3g22760
Presented by:
Matt Emmer
HC70AL
Spring 2006

2. At4g14770 and At3g22760: Tesmin/TSO1-like CXC Domain Proteins
involved in cellular expansion and cytokinesis, as well as in the development of ovules and microspores
Contains two cysteine-rich regions similar to CXC domains involved in chromosome segregation
Tesmin
a member of the CXC family, and a testis-specific protein
Necessary enzyme in gibberellin biosynthetic pathway, involved in mobilization of food in seeds and stem elongation.
Tesmin/cxc/tso-1
Root nodules, cpp,

3. Structure of At4g14770 (1st Line)
Gene Size
3452 bp
# of Exons 8
# of Introns 7
Protein Encoded
Tesmin/TSO1-like
CXC Domain
# of Amino Acids
659
T-DNA Location
First Intron

4. Structure of At3g22760 (2nd Line)?
Gene Size
3076 bp
# of Exons 10
# of Introns 9
Protein Encoded
Tesmin/TSO1-like
CXC Domain
# of Amino Acids
610
T-DNA Location
5’ UTR

5. Where is At4g14770 Expressed?

6. Where is At3g22760 Expressed?

7. Were there Mutants in the 1st Line?WT
Mut
9 Homozygous Mutants Identified in First Line
1 Heterozygous Mutant
Expected Size
Wild Type
802 bp
T-DNA
644 bp

8. Were there Mutants in the 2nd Line?
4.5 ng/μL
Plant 13
1.5 ng/μL
Plant 12
4 ng/μL
Plant 10
15 ng/μL
Plant 4
5 ng/μL
Plant 3
Concentration
Plant
0.5 ng/μL
Wild Type
2 ng/μL
Plant 18
Plant 16
Plant 15
What were the DNA Concentrations?
Were there Mutants in the 2nd Line?
1,624 bp
Wild Type
1,095 bp
T-DNA
Expected Size
No Mutants

9. Genotyping with separate primers

11. Seeds and Silique

12. Embryos

13. Mutant vs. Wild Type
Mutant
Wild Type
Any Difference? NO

14. Single EcoRI Site in Upstream Region
What’s Upstream of At4g14770?
= 3237
1918 bp
3237 bp
1319 bp
I-proof Pcr
Ecori Digest
Single EcoRI Site in Upstream Region

15. Upstream Bioinformatics
Primers
Eco RI Site

16. How accurate was the SP6 and T7 Sequencing Data?
Only a single mismatch in the SP6 sequencing data
Actual Sequence: AAAGTAACGGACATCAGTTTTTTTTTTCTTTTCCCTTTTTTCTCTTTTTTG

17. What’s Upstream of At3g22760?
2911 bp
I-proof Pcr
Ecori Digest

18. Did the T-DNA insert actually knock out At4g14770?

19. Did the T-DNA insert actually knock out At4g14770?
Two Possibilities:
Intron was spliced out
T-DNA was not spliced out, resulting in a longer mRNA strand
Follow up experiment:
Intron could be spliced out, but not necessarily the case.
Intron spliced out: Possible
T-DNA sequence causes transcriptional termination: No
T-DNA not spliced out—get long mRNA strand (mutant protein): possible
T-DNA not spliced out—mRNA targeted for degradation: No

20. Conclusions 1st Line mutants were attained
No mutant phenotype observed
Evidence to suggest that gene knockout was not successful
Limited information obtained for 2nd line
No mutant plants attained
SALK indicates a T-DNA insert is in 5’ UTR, so gene may not have been knocked out
Future Experiments
Double/Triple Knock Outs to overcome duplication:
At4g14770, At3g22760, At3g22780

21. Acknowledgements The TA’s Mike Gaviño Ria Yagnik Jonathan Russell
Big Shots To Be
Tomokazu Kawashima
Brandon Le
Jessica Luke
The Big Shots
Dr. Bob Goldberg
Dr. Anhthu Bui
Dr. Xingjun Wang
HC70AL
Jordan, Thi, Jennifer, Brian, Jordan, Jason, Daisy, Bekah, and Heather
Cool intro slide
What Genes am I working with?
What is the structure of my genes?
What are the properties?
Size
Number of amino acids
Exons and introns
Genotyping Results
Where are my genes active: gene chip/RT-PCR
RT-PCR: expected size, restriction sites, in over-exposure gene is active in leaf refuting gene chip data
Phenotypic Results
T-DNA was inserted in intron. Was it actually knocked out?
Promoter
Expected size, explanation of 3 bands
Matches, ignored, mismatch
Conclusions
Not important to development
Compensated for by another gene (double knockout?)
Not detectable by these experimental procedures
14770 Duplication:At3g22760, At3g22780