Presentation is loading. Please wait.

Presentation is loading. Please wait.

Step 1: amplification and cloning procedures

Similar presentations


Presentation on theme: "Step 1: amplification and cloning procedures"— Presentation transcript:

1 Step 1: amplification and cloning procedures
Genomic DNA miR site DNA cleavage using blunt end-cutting restriction enzymes Adaptor ligation DNA database construction Sequencing of ~200 recombinant plasmids non-target DNA miRNA gene >seq1 acatctagatcaagaaaagcctttgagccgt >seq2 tggagaagcagggcacgtgtacagtctagt >Seq3 tggagaagcagggcacgtgccccagtgatt PCR amplification using one miR primer (red arrow) and one adaptor primer (blue arrow) BLAST searching for miR* sites Re-amplification across miR sites of selected molecules Secondary structure prediction of miRNAs Bacterial cloning Inefficient amplification of non-target DNA due to PCR suppression effect Efficient amplification of mIRNA genes Vector ligation + Step 1: amplification and cloning procedures Step 2: mainly in silico procedures


Download ppt "Step 1: amplification and cloning procedures"

Similar presentations


Ads by Google