1. Bellwork 11/8
IFC: The genetics behind the Punnett square model has been debated thoroughly by scientists. Pete learns to use Punnett squares to predict the outcome of a cross-breeding experiment. Why does he think that he can use the scientific knowledge behind this model to predict the outcomes of his experiment?
A. Models are always accurate.
B. Reginald C. Punnett was a scientist.
C. The square is made from four smaller squares.
Punnett squares have been confirmed by the scientific community. 1.

2. Bellwork 11/12
Many scientists studied the structure of DNA. Watson and Crick used their data to create the structure below. What is the structure below an example of?
Is this an example of a Theory or a Law related to the structure of DNA?
Why does DNA need to make a copy of itself before cell diivision?
Which of the following is NOT empirical evidence supporting what scientists understand about genetics?
A. Identical twins look almost identical.
B. Bioengineering produces plants with desired traits.
C. Cloning is thought to be immoral by some people.
D. Recessive traits may skip generations before appearing again.

3. DNA Structure and Function
EQ: what is DNA?

5. DNA replication – Mitosis & Meiosis

6. What is DNA? Deoxyribonucleic acid An organism’s genetic material
Contains instructions for cell function
Proteins carry out the functions

7. How was DNA discovered?
Many scientists contributed the discovery of DNA:
Rosalind Franklin and Maurice Wilkins used x- ray techniques with DNA that suggested that DNA had a spiral shape
Erwin Chargoff found that the amount of adenine = the amount of Thymine and the amount of guanine = the amount of Cytosine
James Watson and Francis Crick - determine the double helix shape

8. What does DNA look like?
Shape = Double Helix – a twisted ladder:
2 sides = alternating sugar and phosphate
rungs = a pair of nitrogen bases

9. DNA is made up of Nucleotides:
a building block of DNA that consists of:
a sugar
a phosphate
and one nitrogen base –
4 different bases
Adenine (A) and Thymine (T)
Guanine (G) and Cytosine (C)
The nitrogen bases always bond in the same way: A with T
G with C

11. DNA – What does my code look like?
Computer Code:
DNA Code:
ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases…

12. Practice DNA Base Pairs
G A T T A C A
C T A A T G T

13. Build a DNA molecule – you try it!

14. How are copies of DNA made?
DNA replication – process by which the cell makes copies of DNA molecules

16. DNA replication – 1. DNA molecule opens up separating into 2 strands

17. 1. DNA molecule opens up separating into 2 strands

18. DNA replication
2. Each strand becomes a template for a new strand–

19. DNA replication –
3. new bases match up and join to the open DNA strands

20. 4. 2 new identical DNA molecules are formed
DNA replication –
4. 2 new identical DNA molecules are formed
Original DNA strands

21. DNA replication- you try it!

22. Bellwork 11/13 1. 2. What makes up a nucleotide?
Draw a molecule of DNA and label the parts. (include at least 6 base pairs)

23. What are mutations?
Changes in type, number or order of bases on a strand of DNA

24. What causes mutations? Errors during DNA replication
Errors during meiosis
Mutagens - physical or chemical agents that cause mutations

25. What are types of mutations?
Deletion – piece is left out
ATAAGC -> ATAGC
2. Insertion – extra base added
ATAAGC -> ATAACGC
3. Substitution – one base replaces another
ATAAGC -> ATAAGG
sickle cell anemia is caused by a substitution
Insertion mutation

26. Mutations may be beneficial:
Example: Butterflies color
Causes genetic variation/diversity
Female tiger swallowtails can resemble the poisonous black swallowtail

27. Name the type of mutation
Original Strand
Substitution
Insertion
Deletion

28. DNA Video

30. choose and create a graph to display the following data, then make 2 conclusions based on the data.

31. Bellwork 11/14
To investigate the amount of oxygen produced by water plants when exposed to different amounts of sunlight the following experiment was set up.
IFC1 what is the dependent variable?
IFC2 what is the independent variable?
IFC3 why is there a jar with no plant?

32. Which of the following is NOT empirical evidence supporting what scientists understand about genetics?
A. Identical twins look almost identical.
B. Bioengineering produces plants with desired traits.
C. Cloning is thought to be immoral by some people.
D. Recessive traits may skip generations before appearing again.
While scientists already know a great deal about DNA, they continue to learn more about its role in genetics.
What is the basis of scientists’ current understanding of DNA?
A. They guess how they think it works.
B. They use combined empirical evidence from many scientists.
C. They only use evidence that they have personally proven.
D. They assume they already know all there is to know, even when evidence contradicts that assumption.
The genetics behind the Punnett square model has been debated thoroughly by scientists. Pete learns to use Punnett squares to predict the outcome of a cross-breeding experiment.
Why does he think that he can use the scientific knowledge behind this model to predict the outcomes of his experiment?
A. Models are always accurate.
B. Reginald C. Punnett was a scientist.
C. The square is made from four smaller squares.
D. Punnett squares have been confirmed by the scientific community.

33. 1. Draw a molecule of DNA 2. Use the DNA strand A-G-G-G-C-C-T-G
Draw it again with a substitution
Draw it again with an insertion
Draw it again with a deletion