1. Biotechnology Notes
Chapter 9

2. Biotechnology
Scientist change an organism’s DNA to give it new traits.
Possible because all organisms have the same Genetic Code

3. What are the benefits? Insert needed gene into an organism
Make better vegetables/fruits
Identify suspects
Increase biodiversity

4. Restriction Enzymes “Cuts” DNA Act like molecular “scissors”
Lets scientist take out and insert a new gene

5. Restriction Enzymes What are they? protein
Cuts DNA into smaller pieces (molecular scissors)
certain enzymes recognize specific sequences of DNA nucleotides

6. Restriction Enzyme
Different restriction enzymes cut in different places
They recognize nucleotides between 4 and 8 bases long

7. Where does the EcoRI cut?
GCTATAGGAATTCATACCGCCGTAATAGCGAATTC
CGATATCCTTAAGTATGGCGGCATTATCGCTTAAG
The restriction enzyme produces 3 fragments

8. Restriction Enzymes Some cut straight and make “blunt ends”
Some cut staggered and make “sticky ends”

9. Restriction enzymes can make two types of cut sites
1. Sticky has overhang (genetic engineering)
-G AATTC-
-CTTAA G-
a. easily bind to complementary strands in
DNA from other organisms
b. isolate a gene and put into another
strand of DNA (gene cloning)
2. Blunt (DNA fingerprinting and sequencing)
-CCC CCC-
-GGG GGG-

10. Gel electrophoresis
Uses an electrical current to separate DNA sequences that were cut by restriction enzymes.

11. Gel electrophoresis Electrical currents pull the pieces through a gel
Smaller fragments can move faster & farther than longer fragments

12. Gel electrophoresis Each piece creates a band on the gel
Creates a DNA fingerprint
Everyone has their own unique DNA fingerprint

13. DNA Fingerprinting Made by restriction enzymes and gel electrophoresis
What is it used for?
Paternity tests
Evidence in criminal cases
Studying biodiversity
(mother) (child 1) (child 2) (father)

14. http://player. discoveryeducation. com/index. cfm

15. Genetic Engineering Restriction enzymes cut out a specific gene
Gene is inserted into new organism

16. Plasmid loops of DNA in bacteria
restriction enzymes cut plasmid and foreign DNA
foreign gene inserted into plasmid
Contains genes not important for survival
-can be transferred from one bacteria to another

17. Recombinant DNA Contains genes from more than one organism
(bacterial DNA)

18. Transgenic Organism Has one or more genes inserted in it’s DNA
 Has recombinant DNA

19. Transgenic Organism Transgenic bacteria used to make human protein
Gene inserted into plasmid
Plasmid inserted into bacteria
Bacteria makes the protein the gene coded for

20. Uses of Transgenic Organisms
Transgenic plants used in agriculture
Creates crops resistant to frost, diseases, and insects
Food produced more quickly and cheaply

22. Uses of Transgenic Organism
Bacteria with human DNA make human proteins
Ex. Insulin
Cows inserted with genes that produce more milk or human protein-enriched milk

23. Concerns about Genetic Engineering
possible long-term health effects of eating GM foods
possible effects of GM (genetically modified) plants on ecosystems and biodiversity

24. List Genetically Modified Fruit
Papaya-Virus resistant
Pluot-plum and apricot

25. Anti-freeze gene in fish inserted in tomatoes and strawberries

26. Corn with vaccines Ex. Hep A

27. Class work
Genetic Engineer Fruit
1. Vocabulary Chart
Homework