LO 3.18 The student is able to describe the connection between the regulation of gene expression and observed differences between different kinds of organisms.

LO 3.18 The student is able to describe the connection between the regulation of gene
expression and observed differences between different kinds of organisms. LO 3.19 The student is able to describe the connection between the regulation of gene expression and observed differences between individuals in a population. LO 3.22 The student is able to explain how signal pathways mediate gene expression, including how this process can affect protein production. LO 3.23 The student can use representations to describe mechanisms of the regulation of gene expression. LO 4.1 The student is able to explain the connection between the sequence and the subcomponents of a biological polymer and its properties. LO 4.2 The student is able to refine representations and models to explain how the subcomponents of a biological polymer and their sequence determine the properties of that polymer. LO 4.3 The student is able to use models to predict and justify that changes in the subcomponents of a biological polymer affect the functionality of the molecule.

Students Learning Logs check - Monday Thursday – FRQ test – Finished Learning logs due Friday – MC & Math FRQ prep!!!! 1991 Carbon question – Category II only Practice writing with rubric!! Eagle Scout Clothing Drive Extra credit…in lieu of cans Freaking AWESOME video!! Halloween candy sales on Sunday.  Cell phones in bins….off or muted…please & thank you

Chapter 19 Essential Questions
LO 3.20 The student is able to explain how the regulation of gene expression is essential for the processes and structures that support efficient cell function. LO 3.21 The student can use representations to describe how gene regulation influences cell products and function.

Chapter 19: Eukaryotic Genomes: Organization,
Regulation & Evolution

Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution
1. How is chromatin structured on a chromosome? 2 nm 10 nm DNA double helix Histone tails His- tones Linker DNA (“string”) Nucleosome (“bead”) Histone H1 (a) Nucleosomes (10-nm fiber) Protein scaffold 30 nm 300 nm 700 nm 1,400 nm (b) 30-nm fiber (c) Looped domains (300-nm fiber) (d) Metaphase chromosome Loops Scaffold

Signal NUCLEUS Chromatin Chromatin modification: DNA unpacking involving histone acetylation and DNA demethlation Gene DNA Gene available for transcription RNA Exon Transcription Primary transcript RNA processing Transport to cytoplasm Intron Cap mRNA in nucleus Tail CYTOPLASM mRNA in cytoplasm Degradation of mRNA Translation Polypetide Cleavage Chemical modification Transport to cellular destination Active protein Degradation of protein Degraded protein How is chromatin structured on a chromosome? How is gene expression regulated? DNA level – Chromatin changes DNA demethylation Histone acetylation

Students Today – Ch 19: gene regulation National Stress Awareness Day National Chicken Lady Day National Candy Day Monday – Finish Ch 19…last day of quarter Last day to get stuff in for at least a late grade 3:15 review session Tuesday – OFF – go vote…if eligible Wednesday – FRQ test (LL due) 7AM review session Thursday – MC & Math Friday – OFF – sleep in…thank a veteran LL Ch 17 #4 – Edwin vs Claire – who is MOST right? Phones in bin…muted or off…please & thank you!

(a) Histone tails protrude outward from a nucleosome
Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution How is chromatin structured on a chromosome? How is gene expression regulated? DNA level – Chromatin changes DNA demethylation 5% of Cytosines have –CH3 Demethylase removes –CH3 Histone acetylation Chromatin changes Transcription RNA processing mRNA degradation Translation Protein processing and degradation Histone tails DNA double helix Amino acids available for chemical modification (a) Histone tails protrude outward from a nucleosome (b) Acetylation of histone tails promotes loose chromatin structure that permits transcription Unacetylated histones Acetylated histones

How is chromatin structured on a chromosome? How is gene expression regulated? DNA level – Chromatin changes DNA demethylation Histone acetylation Chromatin modifications are responsible for epigenetic inheritance Inheritance of traits by mechanisms not directly involving the DNA sequence Genomic imprinting is also an example of epigenetic inheritance Allele expression in an offspring depends on whether it was inherited on the maternal or paternal chromosome Methylation & acetylation patterns are the same from parent to offspring. - This supports Lamarckian evolution.

Signal NUCLEUS Chromatin Chromatin modification: DNA unpacking involving histone acetylation and DNA demethlation Gene DNA Gene available for transcription RNA Exon Transcription Primary transcript RNA processing Transport to cytoplasm Intron Cap mRNA in nucleus Tail CYTOPLASM mRNA in cytoplasm Degradation of mRNA Translation Polypetide Cleavage Chemical modification Transport to cellular destination Active protein Degradation of protein Degraded protein How is chromatin structured on a chromosome? How is gene expression regulated? DNA level – Chromatin changes DNA demethylation Histone acetylation RNA level Activation of transcription

Figure 19.5 A eukaryotic gene and its transcript
Enhancer (distal control elements) Proximal control elements DNA Upstream Promoter Exon Intron Poly-A signal sequence Termination region Transcription Downstream Poly-A signal Primary RNA transcript (pre-mRNA) 5 Intron RNA RNA processing: Cap and tail added; introns excised and exons spliced together Coding segment P G mRNA 5 Cap 5 UTR (untranslated region) Start codon Stop 3 UTR tail Chromatin changes RNA processing degradation Translation Protein processing and degradation Cleared 3 end of primary transport Proximal and distal control elements farther upstream from promoter Enhancers (activators) or silencers may bind here

Figure 19.6 A model for the action of enhancers and transcription activators
Distal control element Activators Enhancer Promoter Gene TATA box General transcription factors DNA-bending protein Group of Mediator proteins RNA Polymerase II RNA synthesis Transcription Initiation complex Chromatin changes RNA processing mRNA degradation Translation Protein processing and degradation A DNA-bending protein brings the bound activators closer to the promoter. Other transcription factors, mediator proteins, and RNA polymerase are nearby. 2 Activator proteins bind to distal control elements grouped as an enhancer in the DNA. This enhancer has three binding sites. 1 The activators bind to certain general transcription factors and mediator proteins, helping them form an active transcription initiation complex on the promoter. 3 Why is this relevant?? Who cares??

All somatic cells have the same DNA so…
How is cell-specific transcription controlled? Enhancer Promoter Control elements Albumin gene Crystallin Liver cell nucleus Lens cell Available activators expressed gene not Crystallin gene not expressed (a) (b) cell-specific activators Non-active genes are heavily methylated

How is chromatin structured on a chromosome? How is gene expression regulated? DNA level DNA demethylation Histone acetylation RNA level Activation of transcription RNA processing 5’ cap & 3’ poly-A tail Alternative splicing 75% of human genes mRNA transport to cytoplasm mRNA degradation Chromatin changes Transcription RNA processing mRNA degradation Translation Protein processing and degradation Exons DNA Primary RNA transcript RNA splicing or

Figure 19.9 Regulation of gene expression by microRNAs (miRNAs)
Chromatin changes Transcription RNA processing mRNA degradation Translation Protein processing and degradation Degradation of mRNA OR Blockage of translation Target mRNA miRNA Protein complex Dicer Hydrogen bond The micro- RNA (miRNA) precursor folds back on itself, held together by hydrogen bonds. 1 An enzyme called Dicer moves along the double- stranded RNA, cutting it into shorter segments. 2 One strand of each short double- stranded RNA is degraded; the other strand (miRNA) then associates with a complex of proteins. 3 The bound miRNA can base-pair with any target mRNA that contains the complementary sequence. 4 The miRNA-protein complex prevents gene expression either by degrading the target mRNA or by blocking its translation. 5

Signal NUCLEUS Chromatin Chromatin modification: DNA unpacking involving histone acetylation and DNA demethlation Gene DNA Gene available for transcription RNA Exon Transcription Primary transcript RNA processing Transport to cytoplasm Intron Cap mRNA in nucleus Tail CYTOPLASM mRNA in cytoplasm Degradation of mRNA Translation Polypetide Cleavage Chemical modification Transport to cellular destination Active protein Degradation of protein Degraded protein How is chromatin structured on a chromosome? How is gene expression regulated? DNA level DNA demethylation Histone acetylation RNA level Activation of transcription RNA processing mRNA transport to cytoplasm mRNA degradation Protein level Translation Cleavage signal peptide Inactive “-ogen” proteins Chemical modification – Carbs, lipids Transport to organelles Protein degradation

Figure 19.10 Degradation of a protein by a proteasome
Chromatin changes Transcription RNA processing mRNA degradation Translation Protein processing and degradation Ubiquitin Protein to be degraded Ubiquinated protein Proteasome and ubiquitin to be recycled Protein fragments (peptides) Multiple ubiquitin mol- ecules are attached to a protein by enzymes in the cytosol. 1 The ubiquitin-tagged protein is recognized by a proteasome, which unfolds the protein and sequesters it within a central cavity. 2 Enzymatic components of the proteasome cut the protein into small peptides, which can be further degraded by other enzymes in the cytosol. Protein entering a proteasome

How is chromatin structured on a chromosome? How is gene expression regulated? How can proto-oncogenes become oncogenes? Proto-oncogene DNA Translocation or transposition: gene moved to new locus, under new controls Gene amplification: multiple copies of the gene Point mutation within a control element within the gene Oncogene Normal growth-stimulating protein in excess Hyperactive or degradation- resistant protein New promoter

How is chromatin structured on a chromosome? How is gene expression regulated? How can proto-oncogenes become oncogenes? How can disruptions of cell growth pathways lead to cancer?

Figure 19.12 Signaling pathways that regulate cell division
Growth factor MUTATION 2 Receptor p GTP Ras 3 G protein Hyperactive Ras protein (product of oncogene) issues signals on its own 4 Protein kinases (phosphorylation cascade) 5 Transcription factor (activator) NUCLEUS DNA Gene expression Protein that stimulates the cell cycle UV light DNA damage in genome Active form of p53 Defective or missing transcription factor, such as p53, cannot activate inhibits EFFECTS OF MUTATIONS Protein overexpressed Cell cycle overstimulated Increased cell division Cell cycle not inhibited Protein absent (a) Cell cycle–stimulating pathway. This pathway is triggered by a growth factor that binds to its receptor in the plasma membrane. The signal is relayed to a G protein called Ras. Like all G proteins, Ras is active when GTP is bound to it. Ras passes the signal to a series of protein kinases. The last kinase activates a transcription activator that turns on one or more genes for proteins that stimulate the cell cycle. If a mutation makes Ras or any other pathway component abnormally active, excessive cell division and cancer may result. (b) Cell cycle–inhibiting pathway. In this pathway, DNA damage is an intracellular signal that is passed via protein kinases and leads to activation of p53. Activated p53 promotes transcription of the gene for a protein that inhibits the cell cycle. The resulting suppression of cell division ensures that the damaged DNA is not replicated. Mutations causing deficiencies in any pathway component can contribute to the development of cancer. (c) Effects of mutations. Increased cell division, possibly leading to cancer, can result if the cell cycle is overstimulated, as in (a), or not inhibited when it normally would be, as in (b).

How is chromatin structured on a chromosome? How is gene expression regulated? How can proto-oncogenes become oncogenes? How can disruptions of cell growth pathways lead to cancer? What are the differences between prokaryotic & eukaryotic DNA? Prokaryotic Eukaryotic No introns Introns More mutations Few mutations (proofreading) Circular chromosome Several linear chromosomes Not in a nucleus In a nucleus Coupled transcription Separate transcription & translation & translation Mostly coding Mostly “filler”

Figure 19.14 Types of DNA sequences in the human genome
Tandomly repetitive DNA (satellite DNA) – 15% …GTTACGTTACGTTACGTTACGTTAC… Found in telomeres & centromeres Interspersed repetitive DNA – 44% repeats scattered throughout the genome Exons (regions of genes coding for protein, rRNA, tRNA) (1.5%) Repetitive DNA that includes transposable elements and related sequences (44%) Introns and regulatory (24%) Unique noncoding DNA (15%) DNA unrelated to (about 15%) Alu elements (10%) Simple sequence DNA (3%) Large-segment duplications (5–6%)

How is chromatin structured on a chromosome? How is gene expression regulated? How can proto-oncogenes become oncogenes? How can disruptions of cell growth pathways lead to cancer? What are the differences between prokaryotic & eukaryotic DNA? How do eukaryotic transposable elements become repetitive?

Figure 19.16 Movement of eukaryotic transposable elements
Transposon New copy of transposon is copied DNA of genome Insertion Mobile transposon (a) Transposon movement (“copy-and-paste” mechanism) Retrotransposon retrotransposon RNA Reverse transcriptase (b) Retrotransposon movement

Figure 19.15 The effect of transposable elements on corn kernel color

How is chromatin structured on a chromosome? How is gene expression regulated? How can proto-oncogenes become oncogenes? How can disruptions of cell growth pathways lead to cancer? What are the differences between prokaryotic & eukaryotic DNA? How do eukaryotic transposable elements become repetitive? What are gene families? - Collection of identical or very similar genes that are clustered or dispersed throughout the genome

Figure 19.17 Gene families Eukaryotic version of an operon.
DNA RNA transcripts Non-transcribed spacer Transcription unit 18S 5.8S 28S rRNA (a) Part of the ribosomal RNA gene family Heme Hemoglobin -Globin -Globin -Globin gene family -Globin gene family Chromosome 16 Chromosome 11    2  1   G A    Embryo Fetus and adult Adult (b) The human -globin and -globin gene families Eukaryotic version of an operon. - controlled by 1 promoter

How is chromatin structured on a chromosome? How is gene expression regulated? How can proto-oncogenes become oncogenes? How can disruptions of cell growth pathways lead to cancer? What are the differences between prokaryotic & eukaryotic DNA? How do eukaryotic transposable elements become repetitive? What are gene families? How do genes get duplicated or deleted?

Figure 19.18 Gene duplication due to unequal crossing over
Nonsister chromatids Transposable element Gene Incorrect pairing of two homologues during meiosis Crossover and

How is chromatin structured on a chromosome? How is gene expression regulated? How can proto-oncogenes become oncogenes? How can disruptions of cell growth pathways lead to cancer? What are the differences between prokaryotic & eukaryotic DNA? How do eukaryotic transposable elements become repetitive? What are gene families? How do genes get duplicated or deleted? How did the globin gene family evolve?

Figure 19.19 Evolution of the human -globin and -globin gene families
Ancestral globin gene      2 1   G A   -Globin gene family on chromosome 16  -Globin gene family on chromosome 11  Evolutionary time Duplication of ancestral gene Mutation in both copies Transposition to different chromosomes Further duplications and mutations

How is chromatin structured on a chromosome? How is gene expression regulated? How can proto-oncogenes become oncogenes? How can disruptions of cell growth pathways lead to cancer? What are the differences between prokaryotic & eukaryotic DNA? How do eukaryotic transposable elements become repetitive? What are gene families? How do genes get duplicated or deleted? How did the globin gene family evolve? How do new genes evolve? - Exon shuffling

Figure 19.20 Evolution of a new gene by exon shuffling
EGF Epidermal growth factor gene with multiple EGF exons (green) F Fibronectin gene with multiple “finger” exons (orange) Exon shuffling duplication K Plasminogen gene with a “kringle” exon (blue) Portions of ancestral genes TPA gene as it exists today

LO 3.18 The student is able to describe the connection between the regulation of gene expression and observed differences between different kinds of organisms.

Similar presentations

Presentation on theme: "LO 3.18 The student is able to describe the connection between the regulation of gene expression and observed differences between different kinds of organisms."— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

LO 3.18 The student is able to describe the connection between the regulation of gene expression and observed differences between different kinds of organisms.

Similar presentations

Presentation on theme: "LO 3.18 The student is able to describe the connection between the regulation of gene expression and observed differences between different kinds of organisms."— Presentation transcript:

Similar presentations

About project

Feedback