Presentation is loading. Please wait.

Presentation is loading. Please wait.

Chapter 11 DNA Analysis “The capacity to blunder slightly is the

Similar presentations


Presentation on theme: "Chapter 11 DNA Analysis “The capacity to blunder slightly is the"— Presentation transcript:

1 Chapter 11 DNA Analysis “The capacity to blunder slightly is the
07/18/08 Chapter 11 DNA Analysis “The capacity to blunder slightly is the real marvel of DNA. Without this special attribute, we would still be anaerobic bacteria and there would be no music.” —Lewis Thomas, Physician, author

2 Kendall/Hunt Publishing Company
07/18/08 DNA Analysis Students will learn: That DNA is a long-chain polymer found in nucleated cells, which contain genetic information. That DNA can be used to identify or clear potential suspects in crimes. How DNA is extracted and characterized. How to apply the concepts of RFLP, PCR, and STRs to characterize DNA. The role that statistics plays in determining the probability that two people would have the same sequence in a fragment of DNA. The Kendall/Hunt Publishing Company

3 Kendall/Hunt Publishing Company
07/18/08 DNA Analysis Students will be able to: Explain that DNA is a long molecule, tightly packed in the form of a chromosome with genetic material wrapped around it. Isolate and extract DNA from cells. Describe the function and purpose of a restriction enzyme. Calculate probabilities of identity using STR. Kendall/Hunt Publishing Company

4 Historical Information
07/18/08 James Watson and Francis Crick—1953 discovered the configuration of the DNA molecule Ray White—1980 describes first polymorphic RFLP marker Alec Jeffreys—1985 isolated DNA markers and called them DNA fingerprints Kary Mullis—1985 developed PCR testing 1988—FBI starts DNA casework 1991—first STR paper 1998—FBI launches CODIS database 1998 Kendall/Hunt Publishing Company

5 People of Historical Significance
07/18/08 People of Historical Significance James Watson, Francis Crick, and Maurice Wilkins jointly received the Nobel Prize in 1962 for their determination of the structure of DNA. Rosalind Franklin had as much to do with the discovery as the other three gentlemen with her work with X-ray crystallography. She died of cancer and could not be honored for her work. Find out more at Chemical Achievers: Kendall/Hunt Publishing Company

6 General DNA Information
07/18/08 General DNA Information Double helix—two coiled DNA strands Composed of nucleotides—units containing a sugar molecule (deoxyribose), phosphate group and a nitrogen-containing base In humans, the order of these bases is 99.9% the same. Four bases Adenine Cytosine Guanine Thymine Bases always pair A to T and G to C Bases Kendall/Hunt Publishing Company

7 Kendall/Hunt Publishing Company
07/18/08 Where Is DNA Found? Genes are portions of DNA that code for specific proteins DNA is found in all nucleated body cells—white blood cells, semen, saliva, urine, hair root, teeth, bone, tissue Most abundant in buccal (cheek) cells Red blood cells have no nuclei; and therefore, no nuclear DNA DNA obtained from blood comes from white blood cells DNA Kendall/Hunt Publishing Company

8 Kendall/Hunt Publishing Company
07/18/08 DNA Typing DNA typing is a method in which DNA is converted into a series of bands that ultimately distinguish each individual. Only one-tenth of a single percent of DNA (about 3 million bases) differs from one person to the next. Scientists use these regions to generate a DNA profile of an individual. Scientists Kendall/Hunt Publishing Company

9 Kendall/Hunt Publishing Company
07/18/08 Non-Coding Regions 3 percent of the human DNA sequences code for proteins 97 percent is non-coding and is repetitive; repeating the same sequence over and over 50 percent of the human genome has interspersed repetitive sequences 50 Kendall/Hunt Publishing Company

10 Kendall/Hunt Publishing Company
07/18/08 Uses of DNA Profiling To identify potential suspects To exonerate individuals To identify crime and casualty victims To establish paternity To match organ donors To Kendall/Hunt Publishing Company

11 Kendall/Hunt Publishing Company
07/18/08 Types of DNA Nuclear found in the nucleus constitutes 23 pairs of chromosomes inherited from both parents each cell contains only one nuclei Mitochondrial found in the cytoplasm is inherited only from mother each cell contains hundreds to thousands of mitochondria can be found in skeletal remains Nuclear DNA is present in the head of the sperm. Mitochondrial DNA is present in the tail. At conception, the head of the sperm enters the egg and unites with the nucleus. The tail falls off, losing the father’s mitochondrial DNA. Kendall/Hunt Publishing Company Nuclear

12 Kendall/Hunt Publishing Company
07/18/08 Mitochondrial DNA Analysis of mDNA is more: rigorous time consuming costly than nucleic testing of DNA mDNA is constructed in a circular or loop 37 genes are involved in mitochondrial energy generation Is used when nuclear DNA typing is not possible Is Kendall/Hunt Publishing Company

13 Kendall/Hunt Publishing Company
07/18/08 FBI’s CODIS DNA Database Combined DNA Index System Used for linking serial crimes and unsolved cases with repeat offenders Launched October 1998 Links all 50 states Requires >4 RFLP markers and/or 13 core STR markers Kendall/Hunt Publishing Company

14 DNA TYPING “Fingerprinting”
07/18/08 DNA TYPING “Fingerprinting” RFLP—Restriction Fragment Length Polymorphism PCR—Polymerase Chain Reaction STR—Short Tandem Repeats Kendall/Hunt Publishing Company

15 RFLP—Restriction Fragment Length Polymorphisms
07/18/08 RFLP—Restriction Fragment Length Polymorphisms Restriction enzymes are used to cut DNA into smaller fragments that can then be separated and characterized for identification Isolate—separate DNA from the cell Cut—using restriction enzymes to make shorter base strands Sort—by size using electrophoresis Analyze—the specific alleles for identification Kendall/Hunt Publishing Company

16 RFLP – Restriction Enzymes
Bam HI Hae III Pst I BgI EcoRi Cutting Site GGATCC between G and G GGCC between the G and C CTGCAG between the A and G AGATCT between the C and T GAATTC between the G and A

17 RFLP Practice Cut the following sequences with the restriction enzyme given: EcoRi – ATCGAATTCATACCGAATTC TAGCTTAAGTATGGCTTAAG

18 What factors affect DNA evidence?
Several factors can affect the DNA left at a crime scene, such as environmental factors (e.g., heat, sunlight, moisture, bacteria, and mold). Therefore, not all DNA evidence will result in a usable DNA profile. Further, DNA testing cannot identify when the suspect was at the crime scene or for how long. CODIS stands for COmbined DNA Index System, which is an electronic database of DNA profiles that can identify suspects. DNA profiles from individuals convicted of certain crimes, such as rape, murder, and child abuse, are entered into CODIS and help officers identify possible suspects when no prior suspect existed. What is CODIS? Did you know? Each human cell contains three billion DNA base pairs. Our unique DNA amounts to 0.1% or 3 million base pairs. DNA information :

19 Which three statements below are true?
True or False? Which three statements below are true? 1. The DNA in a man's blood is the same as the DNA in his skin cells and saliva. 2. Each person's DNA is different from every other individual's. 3. DNA can be found in all the cells in our bodies except the blood cells. 4. DNA can have forensic value even if it is decades old. 5. DNA evidence was first used to get a conviction in a trial in 1987. Watch the video segment from NOVA: "The Killer's Trail" and be ready to answer the questions on the next slide.

20 Choose the best answer for each.
Video Quiz Choose the best answer for each. 1. Who was the victim? A. Marilyn Sheppard B. Sam Sheppard C. Sam Sheppard, Jr. 2. What are the keys to DNA fingerprinting? Chromosomes B. Alleles C. Nitrogen bases 3. Where did the scientist get the sample of DNA for Marilyn Sheppard? A. Hair B. Skin C. Fingernail 4. Whose blood was found in the blood trail? A. Marilyn Sheppard B. Sam Sheppard C. Neither

21 PCR—Polymerase Chain Reaction
07/18/08 PCR—Polymerase Chain Reaction PCR is a technique used for making copies of a defined segment of a DNA molecule. This can be valuable when the amount of evidence is minimal. Millions of copies of DNA can be made from a single speck of blood. Kendall/Hunt Publishing Company

22 PCR—Polymerase Chain Reaction Procedure
07/18/08 PCR—Polymerase Chain Reaction Procedure Heat the DNA strands, causing the strands to separate (unzip). Cool the mixture and add a primer, a short sequence of base pairs that will add to its complementary sequence on the DNA strand. Finally, add a DNA polymerase and a mixture of free nucleotides to the separated strands. Heat again to around 75° C for the completion. Kendall/Hunt Publishing Company

23 PCR—Polymerase Chain Reaction
07/18/08 PCR—Polymerase Chain Reaction The outcome is a doubling of the number of DNA strands. Heating, cooling, and strand rebuilding is repeated typically 25 to 30 times, yielding more than one million copies of the original DNA molecule. Each cycle takes less than two minutes from start to finish. hill.com/olc/dl/120078/micro15.swf Kendall/Hunt Publishing Company

24 Kendall/Hunt Publishing Company
07/18/08 Advantages of PCR Minute amounts of DNA may be used for amplification. DNA degraded to fragments only a few hundred base pairs in length can serve as effective templates for amplification. Large numbers of copies of specific DNA sequences can be amplified simultaneously with multiplex PCR reactions. Commercial kits are now available for easy PCR reaction setup and amplification. Contaminant DNA, such as fungal and bacterial sources, will not amplify because human-specific primers are used. However, human contamination can be a problem. Kendall/Hunt Publishing Company

25 Kendall/Hunt Publishing Company
Electrophoresis 07/18/08 A technique used to separate DNA fragments. An electrical current is moved through a gel substance causing molecules to sort by size. The smaller, lighter molecules will move the furthest on the gel. After developing, the fragments can be visualized for characterization. Kendall/Hunt Publishing Company

26 Kendall/Hunt Publishing Company
07/18/08 Electrophoresis Pipette the DNA. Kendall/Hunt Publishing Company

27 Kendall/Hunt Publishing Company
07/18/08 Electrophoresis Load DNA into the gel wells. Kendall/Hunt Publishing Company

28 Kendall/Hunt Publishing Company
07/18/08 Electrophoresis Run the gel. Observe and compare bands of DNA. Kendall/Hunt Publishing Company

29 Short Tandem Repeats (STR)
07/18/08 Short Tandem Repeats (STR) STR is another method of DNA typing. STR’s are locations (loci) on the chromosome that contain short sequences of 2 to 5 bases that repeat themselves in the DNA molecule. The advantages of this method are that it provides greater discrimination, requires less time, a smaller sample size, and the DNA is less susceptible to degradation. Kendall/Hunt Publishing Company

30 Kendall/Hunt Publishing Company
07/18/08 Kendall/Hunt Publishing Company

31 Short Tandem Repeats (STR) Procedure
07/18/08 Short Tandem Repeats (STR) Procedure Extract the gene TH01 from the sample. (TH01 has seven human variants with a repeating sequence of A-A-T-G) Amplify the sample by means of PCR Separate by electrophoresis Examine the distance the STR migrates to determine the number of times TH01 repeats Kendall/Hunt Publishing Company

32 Short Tandem Repeats (STR)
07/18/08 Short Tandem Repeats (STR) Each person has two STR types for TH01—one inherited from each parent. By continuing the process with additional STRs from other genes, you can narrow down the probability of DNA belonging to only one person. Kendall/Hunt Publishing Company

33 Short Tandem Repeats (STR)
07/18/08 Short Tandem Repeats (STR) STR typing is visualized by peaks shown on a graph. Each represents the size of the DNA fragment. The possible alleles are numbered for each loci. Kendall/Hunt Publishing Company

34 Profiler Plus Allelic Ladders
07/18/08 Profiler Plus Allelic Ladders D3S1358 VWA FGA AMEL D8S1179 D21S11 D18S51 D5S818 D13S317 D7S820

35 COfiler Allelic Ladders
07/18/08 COfiler Allelic Ladders D3S1358 D16S539 AMEL TH01 TPOX CSF1PO D7S820

36 07/18/08 STR Example

37 07/18/08

38 Determining Probability
07/18/08 Determining Probability Databases have been established that determine how often a particular allele on a loci appears in a given population. By increasing the number of alleles on different loci the probability of having two people with the exact combination becomes miniscule. Kendall/Hunt Publishing Company

39 Kendall/Hunt Publishing Company
07/18/08 DNA Interactive The website below has a STR animation demonstration. Click on human identification, profiling and then on the third circle called Today’s DNA Profiling to see the demonstration. Kendall/Hunt Publishing Company

40 Kendall/Hunt Publishing Company
07/18/08 Three Possible Outcomes Match—The DNA profile appears the same. Lab will determine the frequency. Exclusion—The genotype comparison shows profile differences that can only be explained by the two samples originating from different sources. Inconclusive—The data does not support a conclusion as to whether the profiles match. Kendall/Hunt Publishing Company

41 Kendall/Hunt Publishing Company
07/18/08 The Future Greater automation of the DNA typing process Use of SNP’s—single nucleotide polymorphism which measures a one nucleotide change or difference from one individual to another. More sites are needed to differentiate between individuals (30 to 50 SNPs to attain the frequencies of the 13 STR loci), but it can be done with robots and automation. Kendall/Hunt Publishing Company

42 Kendall/Hunt Publishing Company
07/18/08 People in the News Sir Alec Jeffreys is credited with DNA profiling using RFLP. In September of 1984 after years of work, he saw his first series of blots on an X-ray. The technique was first used in forensics, when in he was asked by police to confirm the rape confession of 17 year old Richard Buckland, who was denying a rape of another young woman. The DNA from Buckland and the DNA taken from the victims eliminated him as a suspect. Jefferys then used samples from other suspects to later convict Colin Pitchfork whose DNA did match. Kendall/Hunt Publishing Company

43 Kendall/Hunt Publishing Company
07/18/08 More about DNA For additional information about DNA and some famous cases, check out Court TV’s Crime Library at: Kendall/Hunt Publishing Company

44 PCR Fingerprinting Post-Lab
Question: Who contributed DNA to the scene? Left: gel 1 – stained w/Bromylthymol Blue Right: gel 2 – stained with Ethydium Bromide and viewed on UV light box


Download ppt "Chapter 11 DNA Analysis “The capacity to blunder slightly is the"

Similar presentations


Ads by Google