1. Chapter 11 DNA Analysis “The capacity to blunder slightly is the
07/18/08
Chapter 11
DNA Analysis
“The capacity to
blunder slightly is the
real marvel of DNA.
Without this special
attribute, we would still
be anaerobic bacteria and
there would be no music.”
—Lewis Thomas, Physician, author

2. Kendall/Hunt Publishing Company
07/18/08
DNA Analysis
Students will learn:
That DNA is a long-chain polymer found in nucleated cells, which contain genetic information.
That DNA can be used to identify or clear potential suspects in crimes.
How DNA is extracted and characterized.
How to apply the concepts of RFLP, PCR, and STRs to characterize DNA.
The role that statistics plays in determining the probability that two people would have the same sequence in a fragment of DNA.
The
Kendall/Hunt Publishing Company

3. Kendall/Hunt Publishing Company
07/18/08
DNA Analysis
Students will be able to:
Explain that DNA is a long molecule, tightly packed in the form of a chromosome with genetic material wrapped around it.
Isolate and extract DNA from cells.
Describe the function and purpose of a restriction enzyme.
Calculate probabilities of identity using STR.
Kendall/Hunt Publishing Company

4. Historical Information
07/18/08
James Watson and Francis Crick—1953 discovered the configuration of the DNA molecule
Ray White—1980 describes first polymorphic RFLP marker
Alec Jeffreys—1985 isolated DNA markers and called them DNA fingerprints
Kary Mullis—1985 developed PCR testing
1988—FBI starts DNA casework
1991—first STR paper
1998—FBI launches CODIS database
1998
Kendall/Hunt Publishing Company

5. People of Historical Significance
07/18/08
People of Historical Significance
James Watson, Francis Crick, and Maurice Wilkins jointly received the Nobel Prize in 1962 for their determination of the structure of DNA.
Rosalind Franklin had as much to do with the discovery as the other three gentlemen with her work with X-ray crystallography.
She died of cancer and could not be honored for her work. Find out more at Chemical Achievers:
Kendall/Hunt Publishing Company

6. General DNA Information
07/18/08
General DNA Information
Double helix—two coiled DNA strands
Composed of nucleotides—units containing a sugar molecule (deoxyribose), phosphate group and a nitrogen-containing base
In humans, the order of these bases is 99.9% the same.
Four bases
Adenine
Cytosine
Guanine
Thymine
Bases always pair A to T and G to C
Bases
Kendall/Hunt Publishing Company

7. Kendall/Hunt Publishing Company
07/18/08
Where Is DNA Found?
Genes are portions of DNA that code for specific proteins
DNA is found in all nucleated body cells—white blood cells, semen, saliva, urine, hair root, teeth, bone, tissue
Most abundant in buccal (cheek) cells
Red blood cells have no nuclei; and therefore, no nuclear DNA
DNA obtained from blood comes from white blood cells
DNA
Kendall/Hunt Publishing Company

8. Kendall/Hunt Publishing Company
07/18/08
DNA Typing
DNA typing is a method in which DNA is converted into a series of bands that ultimately distinguish each individual.
Only one-tenth of a single percent of DNA (about 3 million bases) differs from one person to the next.
Scientists use these regions to generate a DNA profile of an individual.
Scientists
Kendall/Hunt Publishing Company

9. Kendall/Hunt Publishing Company
07/18/08
Non-Coding Regions
3 percent of the human DNA sequences code for proteins
97 percent is non-coding and is repetitive; repeating the same sequence over and over
50 percent of the human genome has interspersed repetitive sequences 50
Kendall/Hunt Publishing Company

10. Kendall/Hunt Publishing Company
07/18/08
Uses of DNA Profiling
To identify potential suspects
To exonerate individuals
To identify crime and casualty victims
To establish paternity
To match organ donors To
Kendall/Hunt Publishing Company

11. Kendall/Hunt Publishing Company
07/18/08
Types of DNA
Nuclear
found in the nucleus
constitutes 23 pairs of chromosomes inherited from both parents
each cell contains only one nuclei
Mitochondrial
found in the cytoplasm
is inherited only from mother
each cell contains hundreds to thousands of mitochondria
can be found in skeletal remains
Nuclear DNA is present in the head of the sperm. Mitochondrial DNA is present in the tail. At conception, the head of the sperm enters the egg and unites with the nucleus. The tail falls off, losing the father’s mitochondrial DNA.
Kendall/Hunt Publishing Company
Nuclear

12. Kendall/Hunt Publishing Company
07/18/08
Mitochondrial DNA
Analysis of mDNA is more:
rigorous
time consuming
costly than nucleic testing of DNA
mDNA is constructed in a circular or loop
37 genes are involved in mitochondrial energy generation
Is used when nuclear DNA typing is not possible Is
Kendall/Hunt Publishing Company

13. Kendall/Hunt Publishing Company
07/18/08
FBI’s CODIS DNA Database
Combined DNA Index System
Used for linking serial crimes and unsolved cases with repeat offenders
Launched October 1998
Links all 50 states
Requires >4 RFLP markers and/or 13 core STR markers
Kendall/Hunt Publishing Company

14. DNA TYPING “Fingerprinting”
07/18/08
DNA TYPING “Fingerprinting”
RFLP—Restriction Fragment Length Polymorphism
PCR—Polymerase Chain Reaction
STR—Short Tandem Repeats
Kendall/Hunt Publishing Company

15. RFLP—Restriction Fragment Length Polymorphisms
07/18/08
RFLP—Restriction Fragment Length Polymorphisms
Restriction enzymes are used to cut DNA into smaller fragments that can then be separated and characterized for identification
Isolate—separate DNA from the cell
Cut—using restriction enzymes to make shorter base strands
Sort—by size using electrophoresis
Analyze—the specific alleles for identification
Kendall/Hunt Publishing Company

16. RFLP – Restriction Enzymes
Bam HI
Hae III
Pst I
BgI
EcoRi
Cutting Site
GGATCC between G and G
GGCC between the G and C
CTGCAG between the A and G
AGATCT between the C and T
GAATTC between the G and A

17. RFLP Practice
Cut the following sequences with the restriction enzyme given:
EcoRi – ATCGAATTCATACCGAATTC
TAGCTTAAGTATGGCTTAAG

18. What factors affect DNA evidence?
Several factors can affect the DNA left at a crime scene, such as environmental factors (e.g., heat, sunlight, moisture, bacteria, and mold). Therefore, not all DNA evidence will result in a usable DNA profile. Further, DNA testing cannot identify when the suspect was at the crime scene or for how long.
CODIS stands for COmbined DNA Index System, which is an electronic database of DNA profiles that can identify suspects. DNA profiles from individuals convicted of certain crimes, such as rape, murder, and child abuse, are entered into CODIS and help officers identify possible suspects when no prior suspect existed.
What is CODIS?
Did you know?
Each human cell contains three billion DNA base pairs. Our unique DNA amounts to 0.1% or 3 million base pairs.
DNA information :

19. Which three statements below are true?
True or False?
Which three statements below are true?
1. The DNA in a man's blood is the same as the DNA in his skin cells and saliva.
2. Each person's DNA is different from every other individual's.
3. DNA can be found in all the cells in our bodies except the blood cells.
4. DNA can have forensic value even if it is decades old.
5. DNA evidence was first used to get a conviction in a trial in 1987.
Watch the video segment from NOVA: "The Killer's Trail" and be ready to answer the questions on the next slide.

20. Choose the best answer for each.
Video Quiz
Choose the best answer for each.
1. Who was the victim?
A. Marilyn Sheppard B. Sam Sheppard C. Sam Sheppard, Jr.
2. What are the keys to DNA fingerprinting?
Chromosomes B. Alleles C. Nitrogen bases
3. Where did the scientist get the sample of DNA for Marilyn Sheppard?
A. Hair B. Skin C. Fingernail
4. Whose blood was found in the blood trail?
A. Marilyn Sheppard B. Sam Sheppard C. Neither

21. PCR—Polymerase Chain Reaction
07/18/08
PCR—Polymerase Chain Reaction
PCR is a technique used for making copies of a defined segment of a DNA molecule. This can be valuable when the amount of evidence is minimal. Millions of copies of DNA can be made from a single speck of blood.
Kendall/Hunt Publishing Company

22. PCR—Polymerase Chain Reaction Procedure
07/18/08
PCR—Polymerase Chain Reaction Procedure
Heat the DNA strands, causing the strands to separate (unzip).
Cool the mixture and add a primer, a short sequence of base pairs that will add to its complementary sequence on the DNA strand.
Finally, add a DNA polymerase and a mixture of free nucleotides to the separated strands. Heat again to around 75° C for the completion.
Kendall/Hunt Publishing Company

23. PCR—Polymerase Chain Reaction
07/18/08
PCR—Polymerase Chain Reaction
The outcome is a doubling of the number of DNA strands. Heating, cooling, and strand rebuilding is repeated typically 25 to 30 times, yielding more than one million copies of the original DNA molecule. Each cycle takes less than two minutes from start to finish.
hill.com/olc/dl/120078/micro15.swf
Kendall/Hunt Publishing Company

24. Kendall/Hunt Publishing Company
07/18/08
Advantages of PCR
Minute amounts of DNA may be used for amplification.
DNA degraded to fragments only a few hundred base pairs in length can serve as effective templates for amplification.
Large numbers of copies of specific DNA sequences can be amplified simultaneously with multiplex PCR reactions.
Commercial kits are now available for easy PCR reaction setup and amplification.
Contaminant DNA, such as fungal and bacterial sources, will not amplify because human-specific primers are used. However, human contamination can be a problem.
Kendall/Hunt Publishing Company

25. Kendall/Hunt Publishing Company
Electrophoresis
07/18/08
A technique used to separate DNA fragments.
An electrical current is moved through a gel substance causing molecules to sort by size.
The smaller, lighter molecules will move the furthest on the gel.
After developing, the fragments can be visualized for characterization.
Kendall/Hunt Publishing Company

26. Kendall/Hunt Publishing Company
07/18/08
Electrophoresis
Pipette the DNA.
Kendall/Hunt Publishing Company

27. Kendall/Hunt Publishing Company
07/18/08
Electrophoresis
Load DNA into the gel wells.
Kendall/Hunt Publishing Company

28. Kendall/Hunt Publishing Company
07/18/08
Electrophoresis
Run the gel.
Observe and compare bands of DNA.
Kendall/Hunt Publishing Company

29. Short Tandem Repeats (STR)
07/18/08
Short Tandem Repeats (STR)
STR is another method of DNA typing. STR’s are locations (loci) on the chromosome that contain short sequences of 2 to 5 bases that repeat themselves in the DNA molecule. The advantages of this method are that it provides greater discrimination, requires less time, a smaller sample size, and the DNA is less susceptible to degradation.
Kendall/Hunt Publishing Company

30. Kendall/Hunt Publishing Company
07/18/08
Kendall/Hunt Publishing Company

31. Short Tandem Repeats (STR) Procedure
07/18/08
Short Tandem Repeats (STR) Procedure
Extract the gene TH01 from the sample. (TH01 has seven human variants with a repeating sequence of A-A-T-G)
Amplify the sample by means of PCR
Separate by electrophoresis
Examine the distance the STR migrates to determine the number of times TH01 repeats
Kendall/Hunt Publishing Company

32. Short Tandem Repeats (STR)
07/18/08
Short Tandem Repeats (STR)
Each person has two STR types for TH01—one inherited from each parent.
By continuing the process with additional STRs from other genes, you can narrow down the probability of DNA belonging to only one person.
Kendall/Hunt Publishing Company

33. Short Tandem Repeats (STR)
07/18/08
Short Tandem Repeats (STR)
STR typing is visualized by peaks shown on a graph. Each represents the size of the DNA fragment.
The possible alleles are numbered for each loci.
Kendall/Hunt Publishing Company

34. Profiler Plus Allelic Ladders
07/18/08
Profiler Plus Allelic Ladders
D3S1358
VWA
FGA
AMEL
D8S1179
D21S11
D18S51
D5S818
D13S317
D7S820

35. COfiler Allelic Ladders
07/18/08
COfiler Allelic Ladders
D3S1358
D16S539
AMEL
TH01
TPOX
CSF1PO
D7S820

36. 07/18/08
STR Example

37. 07/18/08

38. Determining Probability
07/18/08
Determining Probability
Databases have been established that determine how often a particular allele on a loci appears in a given population. By increasing the number of alleles on different loci the probability of having two people with the exact combination becomes miniscule.
Kendall/Hunt Publishing Company

39. Kendall/Hunt Publishing Company
07/18/08
DNA Interactive
The website below has a STR animation demonstration. Click on human identification, profiling and then on the third circle called Today’s DNA Profiling to see the demonstration.
Kendall/Hunt Publishing Company

40. Kendall/Hunt Publishing Company
07/18/08
Three Possible Outcomes
Match—The DNA profile appears the same. Lab will determine the frequency.
Exclusion—The genotype comparison shows profile differences that can only be explained by the two samples originating from different sources.
Inconclusive—The data does not support a conclusion as to whether the profiles match.
Kendall/Hunt Publishing Company

41. Kendall/Hunt Publishing Company
07/18/08
The Future
Greater automation of the DNA typing process
Use of SNP’s—single nucleotide polymorphism which measures a one nucleotide change or difference from one individual to another. More sites are needed to differentiate between individuals (30 to 50 SNPs to attain the frequencies of the 13 STR loci), but it can be done with robots and automation.
Kendall/Hunt Publishing Company

42. Kendall/Hunt Publishing Company
07/18/08
People in the News
Sir Alec Jeffreys is credited with DNA profiling using RFLP. In September of 1984 after years of work, he saw his first series of blots on an X-ray. The technique was first used in forensics, when in he was asked by police to confirm the rape confession of 17 year old Richard Buckland, who was denying a rape of another young woman. The DNA from Buckland and the DNA taken from the victims eliminated him as a suspect. Jefferys then used samples from other suspects to later convict Colin Pitchfork whose DNA did match.
Kendall/Hunt Publishing Company

43. Kendall/Hunt Publishing Company
07/18/08
More about DNA
For additional information about DNA and some famous cases, check out Court TV’s Crime Library at:
Kendall/Hunt Publishing Company

44. PCR Fingerprinting Post-Lab
Question:
Who contributed DNA to the scene?
Left: gel 1 – stained w/Bromylthymol Blue
Right: gel 2 – stained with Ethydium Bromide and viewed on UV light box