Presentation is loading. Please wait.

Presentation is loading. Please wait.

Evolving Resistance: Research Goals and Goods

PublishΣιληνός Δασκαλοπούλου Modified over 5 years ago

Similar presentations

Presentation on theme: "Evolving Resistance: Research Goals and Goods"— Presentation transcript:

1 Evolving Resistance: Research Goals and Goods
Georgiana May Brett Couch Ethy Cannon University of Minnesota

2 Education Training Evolution Map Resistance Resources

3 Ever since Grube et al. Chromosome 11S I2 R3,7 RB
Grube et al. assembled data suggesting that the rapid rearrangment model is not supported and that chromoosomal locations of R genes are conserved RB

4 I2- homologous sequences in Solanaceae
Tomato Potato S. dem. Eggplant Pepper Tobacco Couch et al. MPMI 2006

5 I2- h NBS sequences under positive selection

6 NBS LRR NBS and LRR regions reassociate through time

7 Contributions and resources
Birth-death model applies to R gene evolution 232 sequences from 6 species positive selection evolving function? seek new resistance function in fewer than 10 lineages Brett Couch David Schladt

8 I2 lineages maintained 12 million years
Ancient duplications

9 Contributions and resources
Long term maintenance of R gene lineages - 12 my 232 sequences from 6 species maintained through speciation maintain function? seek non-host R in fewer than 10 lineages Brett Couch

10 I2-h map to chromosomes 8,9,11 in tomato
B B B B B IL Block B BAC contig

11 250 tomato BAC clones hybridized to I2 probes
Oligo probes hybridize to specifc I2 homologs

12 Map I2-containing BAC clones to IL segment
PCR length polymorphisms in parent lines BAC end polymorphisms segregate in the L. pinnellii mapping population

13 Contributions and resources
Verified Pan, Fluhr results chromosomes 8,9,11 not on 3,4 (Pan) New region - 9 I Ancient chromosomal duplications carry R gene duplications Brett Couch Deren Eaton

14 Conceptualimportance: Birth-Death = recombining and long term maintenance = non-recombining?
Informatic - characteristics of genes that are of value to agriculture How to find them using evolutionary analyses and where are they likely to reside in the genome? Baumgarten et al. 2002 R

15 Goods solevol demo site Ethalinda Cannon

16 examples

17 Resistance Resources 75 distinct I2-h lineages Genome locations
over 6 species Genome locations Development of evolutionary models Training

18 Education Training Evolution Map Resistance Resources

Download ppt "Evolving Resistance: Research Goals and Goods"

Similar presentations

Slide 6.2. Slide 6.3 Dominance and recessiveness - both alleles may encode proteins; example - eye colour -the gene that encodes the protein that does.

Slide 6.2. Slide 6.3 Dominance and recessiveness - both alleles may encode proteins; example - eye colour -the gene that encodes the protein that "does.
Sequences, Sequences,Sequences and what they might mean.

Sequences, Sequences,Sequences and what they might mean.
History, protohistory and prehistory of the Arabidopsis thaliana chromosome complement Henry Yves et al 2006, in press.

History, protohistory and prehistory of the Arabidopsis thaliana chromosome complement Henry Yves et al 2006, in press.
Comparative genomics Joachim Bargsten February 2012.

Comparative genomics Joachim Bargsten February 2012.
The bonobo genome compared with the chimpanzee and human genomes Kay Pruüfer et al. Nature (June,2012) Presenter: Chia-Ying Chen.

The bonobo genome compared with the chimpanzee and human genomes Kay Pruüfer et al. Nature (June,2012) Presenter: Chia-Ying Chen.
A Look into the Process of Marker Development Matt Robinson.

A Look into the Process of Marker Development Matt Robinson.
Cloning lab results Cloning the human genome Physical map of the chromosomes Genome sequencing Integrating physical and recombination maps Polymorphic.

Cloning lab results Cloning the human genome Physical map of the chromosomes Genome sequencing Integrating physical and recombination maps Polymorphic.
9 Genomics and Beyond Brief Chapter Outline

9 Genomics and Beyond Brief Chapter Outline
Physical Mapping I CIS 667 February 26, 2004. Physical Mapping A physical map of a piece of DNA tells us the location of certain markers  A marker is.

Physical Mapping I CIS 667 February 26, Physical Mapping A physical map of a piece of DNA tells us the location of certain markers  A marker is.
The role of parallel genetic changes in domestication: Fruit size in the plant family Solanaceae Matt Robinson.

The role of parallel genetic changes in domestication: Fruit size in the plant family Solanaceae Matt Robinson.
BACKGROUND E. coli is a free living, gram negative bacterium which colonizes the lower gut of animals. Since it is a model organism, a lot of experimental.

BACKGROUND E. coli is a free living, gram negative bacterium which colonizes the lower gut of animals. Since it is a model organism, a lot of experimental.
Genetic and physical maps around the sex-determining M- locus of the dioecious plant asparagus Telgmann-Rauber et al. 2007.

Genetic and physical maps around the sex-determining M- locus of the dioecious plant asparagus Telgmann-Rauber et al
Genome sequencing. Vocabulary Bac: Bacterial Artificial Chromosome: cloning vector for yeast Pac, cosmid, fosmid, plasmid: cloning vectors for E. coli.

Genome sequencing. Vocabulary Bac: Bacterial Artificial Chromosome: cloning vector for yeast Pac, cosmid, fosmid, plasmid: cloning vectors for E. coli.
Genome Analysis Determine locus & sequence of all the organism’s genes More than 100 genomes have been analysed including humans in the Human Genome Project.

Genome Analysis Determine locus & sequence of all the organism’s genes More than 100 genomes have been analysed including humans in the Human Genome Project.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Comparison of Drosophila Genomes Li-Lun, Ho. D. melanogaster vs. D. yakuba D. yakuba genome is assembled in Apr, 2004. D. yakuba genome has 14 times higher.

Comparison of Drosophila Genomes Li-Lun, Ho. D. melanogaster vs. D. yakuba D. yakuba genome is assembled in Apr, D. yakuba genome has 14 times higher.
Dept. of Plant Breeding & Genetics, Cornell University

Dept. of Plant Breeding & Genetics, Cornell University
Mouse Genome Sequencing

Mouse Genome Sequencing
AP Biology Ch. 20 Biotechnology.

AP Biology Ch. 20 Biotechnology.
SOL Genomics Network Formed in 2003 to answer two questions: – How can a common set of genes give rise to such a wide range of morphologically and ecologically.

SOL Genomics Network Formed in 2003 to answer two questions: – How can a common set of genes give rise to such a wide range of morphologically and ecologically.

Similar presentations

Ads by Google