1. DNA & Protein Synthesis
From Gene to Protein

2. Nucleic Acids and Protein Synthesis
All functions of a cell are directed from some central form of information (DNA).
This "biological program" is called the Genetic Code.
This is the way cells store information regarding their structure and function.

3. Composition and Structure
History of DNA
Composition and Structure

4. History
For years the source of heredity was unknown. This was resolved after numerous studies and experimental research by the following researchers:
Fredrick Griffith
He was studying effects of 2 strains of an infectious bacteria, the "smooth" strain was found to cause pneumonia & death in mice. The "rough" strain did not. He conducted the following experiment

5. Griffith Experiment Bacteria Strain injected into mouse Result
Smooth Strain
Mouse dies
Rough strain
Mouse Lives
Heat-Killed Smooth strain
Mouse lives
Rough Strain & Heat killed smooth strain
*MOUSE DIES*
The last condition was unusual, as he predicted that the mouse should live
Concluded that some unknown substance was Transforming the rough strain into the smooth one

6. Avery, McCarty & MacLeod
Tried to determine the nature of this transforming agent.
Was it protein or DNA?
They Degraded chromosomes with enzymes that destroyed proteins or DNA
The Samples with Proteins destroyed would still cause transformation in bacteria indicating genetic material was DNA

7. Hershey-Chase
ONE virus was radioactively "tagged" with 32P on it's DNA
The OTHER was "tagged" 35S on it's protein coat.
Researchers found the radioactive P in the bacteria, indicating it is DNA, not protein being injected into bacteria.

8. Watson & Crick
The constituents of DNA had long been known. Structure of DNA, however was not.
In 1953, Watson & Crick published findings based on X-ray analysis (Rosalind Franklin) and other data that DNA was in the form of a "Double Helix".
Their findings show us the basic structure of DNA which is as follows.

9. DNA Structure
The Double Helix

10. DNA is Formed of in a "Double Helix" - like a spiral staircase
DNA Structure
DNA is Formed of in a "Double Helix" - like a spiral staircase

11. Nucleotides DNA is formed by Nucleotides
These are made from three components:
5-Carbon or pentose Sugar
Nitrogenous base
Phosphate group

12. Types of Nucleotides
For DNA There are 4 different Nucleotides categorized as either Purines (Double rings) or Pyrimidines (Single ring). These are usually represented by a letter. They Are:
Adenine (A)
Cytosine (C)
Guanine (G)
Thymine (T)
Guanine

13. Base Pairing
Each "Rung" of the DNA "staircase" is formed by the linking of 2 Nucleotides through Hydrogen Bonds.
These Hydrogen bonds form only between specific Nucleotides. This is known as Base Pairing. The rules are as follows:
Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen bonds)
Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen bonds)

14. Central Dogma of Genetics
DNA to Protein Synthesis

15. Central Dogma of Genetics
Central Dogma holds that genetic information is expressed in a specific order. This order is as follows
There are some apparent exceptions to this.
Retroviruses (eg. HIV) are able to synthesize DNA from RNA

16. DNA Replication DNA has unique ability to make copies of itself
The process is called DNA Replication.
First, the enzyme Helicase unwinds the parental DNA
DNA "Unzips itself" by breaking the weak hydrogen bonds between base pairs forming two TEMPLATE strands with exposed Nucleotides

17. DNA Replication
The place where helicase attaches and opens DNA is called the Replication Fork
REPLICATION FORK

18. DNA Replication
Helicase enzymes may attach to multiple sites on the DNA strand forming Replication Bubbles which makes replication faster

19. DNA Replication
Single-strand binding proteins attach & STABILIZE the 2 parental strands
DNA polymerase attaches to the 3’ end of the 5’ to 3’ parental strand
DNA polymerase attaches FREE nucleotides to the complementary nucleotide on the parental DNA
This new strand is synthesized continuously 5’ to 3’ (LEADING)

20. Replication Bubble
DNA is synthesized from the Origin of Replication within a replication bubble
Towards fork – continuous replication
Away from fork – discontinuous replication (fragments)
Origin of Replication
Origin of Replication

21. DNA Replication
Since DNA polymerase can only add nucleotides to the 3’ end of the parental strand, the parental 5’ to 3’ strand must be replicated in fragments that must later be joined together (LAGGING)

23. DNA Replication
Transcription proceeds continuously along the 5'3' direction (This is called the leading strand)
Proceeds in fragments in the other direction (called the lagging strand) in the following way
RNA primer is attached to a segment of the strand by the enzyme primase.

24. DNA Replication
Transcription now continues in the 5'3' direction forming an okazaki fragment. Until it reaches the next fragment.
The two fragments are joined by the enzyme DNA ligase
Two, new, identical DNA strands are now formed

25. DNA Replication

26. Transcription and Translation
Protein Synthesis
Transcription and Translation

27. RNA Transcription
The cell does not directly use DNA to control the function of the cell.
DNA is too precious and must be kept protected within the nucleus.
The Cell makes a working "Photocopy" of itself to do the actual work of making proteins.
This copy is called Ribonucleic Acid or RNA.
RNA differs from DNA in several important ways.
It is much smaller
It is single-stranded
It does NOT contain Thymine, but rather a new nucleotide called Uracil which will bind to Adenine
Contains ribose, not deoxyribose sugar

28. RNA Transcription
RNA is produced through a process called RNA Transcription.
Similar to DNA Replication.
Small area of DNA "Unzips" exposing Nucleotides
This area is acted on by an enzyme called RNA Polymerase, which binds nucleotides (using uracil) to their complementary base pair.
This releases a long strand of Messenger RNA (mRNA) which is an important component of protein synthesis.

29. RNA Transcription

30. Protein Synthesis & The Genetic Code
The Sequence of nucleotides in an mRNA strand determine the sequence of amino acids in a protein
Process requires mRNA, tRNA & ribosomes
Polypeptide chains are synthesized by linking amino acids together with peptide bonds

31. mRNA
Each three Nucleotide sequence in an mRNA strand is called a "Codon“
Each Codon codes for a particular amino acid.
The codon sequence codes for an amino acid using specific rules. These specific codon/amino acid pairings is called the Genetic Code.

32. tRNA There is a special form of RNA called Transfer RNA or tRNA.
Each tRNA has a 3 Nucleotide sequence on one end which is known as the "Anitcodon"
This Anticodon sequence is complimentary to the Codon sequence found on the strand of mRNA
Each tRNA can bind specifically with a particular amino acid.

33. Ribosome Consists of two subunits made of protein & rRNA Large subunit
Small subunit
Serves as a template or "work station" where protein synthesis can occur.

34. Protein Synthesis
First, an mRNA strand binds to the large & small subunits of a ribosome in the cytosol of the cell
This occurs at the AUG (initiation) codon of the strand.
The ribosome has 3 binding sites for codons --- E (exit site), P, and A (entry site for new tRNA)
The ribosome moves along the mRNA strand

35. Protein Synthesis
An anticodon on tRNA binds to a complementary codon on mRNA.
The tRNA carrying an amino acid enters the A site on the ribosome
The ribosome moves down the mRNA so the tRNA is now in the P site and another tRNA enters the A site
A peptide bond is formed between the amino acids and the ribosome moves down again
The first tRNA is released, and another tRNA binds next to the second, another peptide bond is formed.
This process continues until a stop codon (UAG…) is reached.
The completed polypeptide is then released.

36. Protein Synthesis

38. Replication Problem
Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand?
3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

39. Answer
Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand?
3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’

40. RNA Transcription Problem
Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand?
3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

41. ANSWER
Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand?
3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

42. Codon / Anticodon
Given a mRNa strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands?
3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

43. Answer
Given a mRNA strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands?
3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’
3’ – UACCACGUGGAUGAGGACUCCUCUUCAGA -5’

44. Protein Translation
Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide?
AUGGUGCACCUGACUCCUGAGGAGAAGUCU

45. Protein Translation / Answer
Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide?
AUGGUGCACCUGACUCCUGAGGAGAAGUCU
Met-val-his-leu-thr-pro-glu-glu-lys-ser