Presentation is loading. Please wait.

Presentation is loading. Please wait.

Modified Cas9 with higher specificity

Similar presentations


Presentation on theme: "Modified Cas9 with higher specificity"— Presentation transcript:

1 Modified Cas9 with higher specificity
Sniper Cas9 : Modified Cas9 with higher specificity 2018

2 Increasing specificity of CRISPR-Cas9: Towards SNP differentiation
Genome Technology Increasing specificity of CRISPR-Cas9: Towards SNP differentiation Cell Strategies to improve specificity of CRISPR-Cas9 sg-RNA - Addition of G at 5’ end of sgRNA - Truncation of spacer sequence from 20 to 17-mer Cas9 protein - Site-directed mutation of Cas9 protein Off-target: SNP Off-target effect more important Improved Cas9 protein need to lower off-targeting notably without sacrificing on-targeting. It can work well with improved gRNA as well. On-target

3 Rational design vs Directed evolution
Library construction Crystal structure Site directed mutation Activity test Shuffling Screening system

4 Selection Scheme: Sniper-Screen can select Cas9 variant with high specificity
(induces ccdB) (induces sgRNA and Cas9)

5 No position overlaps with eSpCas9, HF-Cas9 or Hypa-Cas9, evo Cas9 or
Mutant location of Sniper Cas9s No position overlaps with eSpCas9, HF-Cas9 or Hypa-Cas9, evo Cas9 or xCas9 3.7 Sniper 1 showed highest activity Extensive site directed mutation study  original Sniper 1 is the best Comparison of Sniper 1 with other engineered Cas9s

6 Compare data : Sniper Cas9 with other Cas9 variants in FANCF01
Specificity ratio = on-target activity / off-target activity (normalized to WT Cas9 activity)

7 Compare data : Sniper Cas9 with other Cas9 variants in AAVS

8 Grey box: range above 70% of WT Cas9 activity
Sniper Cas9 do not sacrifice on-target activity Grey box: range above 70% of WT Cas9 activity

9 Six targets under specificity ratio 10 Ribonucleoprotein (RNP) form
Sniper Cas9 works well both plasmis form and RNP form Six targets under specificity ratio 10 Ribonucleoprotein (RNP) form

10 hEMX1 base editing via BE3: C to T
Sniper Cas9 works well with Base Editors hEMX1 base editing via BE3: C to T Sniper-BE3 with truncated sgRNA: near background level without loss of on-target activity aAGTCCGAGgAGAgGAAGAAAGG GAGTCCaAGCAGtAGAgGAAGGG GAGTCCtAGCAGgAGAAGAAGAG GAaTCCaAGCAGAAGAAGAgAAG GAGTCtaAGCAGAAGAAGAAGAG GAGTCCGAGCAGAAGAAGAAGGG

11 Sniper Cas9 shows same specificity in iPS and primary cells
On-target specificity of sniper Cas9 paired with gX19 targeting AAVS in iPS and T cells

12 - is compatible with truncated or extended sgRNAs. Sniper Cas9
Summary SniperCas9 - is compatible with both matching (G) and mismatching (g) 5’ G of sgRNAs. - is compatible with truncated or extended sgRNAs. Sniper Cas9 - shows the highest specificity among various SpCas9 variants without sacrificing on-target activity. Sniper Cas9 works well in both plasmid form and RNP form. Sniper Cas9 works well with BE3 - reduces off-targeting near background level with truncated sgRNA. Sniper Cas9 shows the same specificity in iPS and primary cells as cell lines.


Download ppt "Modified Cas9 with higher specificity"

Similar presentations


Ads by Google