1. DNA Replication

2. Learning Objectives
Explain what DNA replication is and the purpose

3. What is DNA Replication?
DNA Replication - the process of making two identical copies of DNA from the original parent DNA

4. Purpose of DNA Replication
DNA has to be copied before a cell divides
DNA is replicated during the S phase of interphase
New daughter cells have an identical set of DNA.

5. Where Does Replication Occur?
Nucleus
DNA Replication occurs in the nucleus

6. How does DNA replication start?
Replication starts at the Origin of Replication
The parent DNA strand unzips forming a
Replication Fork

7. Replication Bubbles
Each DNA strand has multiple sites of replication - replication bubbles
Replication proceeds in both directions until each chromosome is completely copied.

8. DNA Template
Each side of the parent DNA strand serves as the template for the new strands

9. Complementary DNA Strands
Two new complementary DNA strands are made following the rules of base pairing
G C
A T

10. Stop Here

11. Steps of DNA Replication

12. Learning Objectives
Describe the steps of DNA replication

13. Step 1: Uncoil and Unzip - Helicase
The enzyme Helicase unwinds and separates the 2 DNA strands by breaking the weak hydrogen bonds.

14. Primase Creates a Primer
Primase tells DNA polymerase where to start replication.

15. Step 2: DNA Polymerase makes new DNA strand
DNA polymerase adds individual nucleotides to produce a complementary DNA strand

16. Direction of replication
DNA replication occurs in a 5’ to 3’ direction

17. DNA Ligase
Ligase joins the sections of DNA together

18. Semi-Conservative Replication
Two identical copies of DNA are made, each containing one original strand and one new strand.

19. Steps of DNA Replication
Uncoil and unzip parent DNA molecule
Complementary nucleotide bases forms new hydrogen bonds with parent strand
Each new DNA molecule contains one old strand and one new strand (semi-conservative replication)

20. Practice DNA Replication
Original DNA: TCCTGACCCCGCCCGGAT
AGGACTGGGGCGGGCCTA
Original DNA: CCTATATCTCTCTATATCTC
GGATATAGAGAGATATAGAG

21. Amoeba Sisters DNA Replication
YouTube Video Honors
Amoeba Sisters DNA Replication

22. YouTube Video Lab Biology
DNA Replication by Interact Medical

23. Stop Here

24. Where Does Replication Occur?
DNA Replication occurs in the nucleus