1. CONFIDENTIAL Missing Falcon!
These slides (3-7) are introduction slides to present the case to the students
Use this to get them excited about what is to come. Explain that now we will learn a little more about DNA in order to have the information we need to solve the crime. Courtesy of Anne Purfield and Sarah Taylor at UNC-CH! DNA DAY 2007

2. Briefing
It’s a big week at Jordan High School and your school has been getting fired up for the upcoming baseball game against Riverside High.
In the midst of everyone’s excitement for the big game, disaster has occurred. Mr. Leathers has just announced to the faculty and students that the Falcon, the school mascot, is nowhere to be found.
A sealed envelope was left on the baseball field, and inside the faculty has found the following ransom note…
There are blank spots (usually denoted by a ______________), in which you should insert the appropriate information for the school you will be attending.

3. The senior class at Riverside is proud to have pulled off its greatest prank yet. We have taken the Falcon, your precious mascot. If you want him back, your baseball team will have to forfeit your game against our Pirates this weekend. Otherwise, the Falcon stays here with us indefinitely.
To the Students of JHS,
- RHS Class of 2012
Use this to get them excited about what is to come. Explain that now we will learn a little more about DNA in order to have the information we need to solve the crime.
The Evidence

4. Collecting DNA samples
The principal of Riverside has agreed that such a stunt is not in keeping with the true spirit of rivalry week or the annual senior pranks.
The principal has therefore requested that each RHS senior voluntarily submit a DNA sample to identify the captor based on DNA taken from the envelope that carried the ransom letter.
90% of the students agreed.
The RHS Principal therefore demanded that the remaining 10% submit a sample or face immediate suspension.
Ultimately, samples are collected from all students.

5. Your Objective
The DNA analyst has been working night and day to get through the countless samples, but hasn’t found the captor. She is exhausted and has therefore decided to go on strike.
Mr. Leathers is impatient to identify the thief and retrieve your beloved mascot.
He has therefore asked your class to help finish data analysis.

6. DNA
Let’s discuss DNA and how forensic scientists analyze DNA so that you can solve this crime!

7. DNA What does DNA stand for? What is DNA?
Deoxyribonucleic Acid
What is DNA?
A chemical compound, contains genetic information for the function of living organisms
What is the structure of DNA?
Double Helix
Is DNA negatively or positively charged?
Negatively charged
Engage the class by asking the following questions
What does DNA stand for? DNA stands for Deoxyribonucleic acid
What is the function of DNA? DNA is the chemical compound that contains the genetic information for the function of living organisms
What is the structure of DNA? DNA is made of two twisting, paired strands of chemical units called nucleotide bases, which form the double helix that Watson and Crick described over 50 years ago.
Is DNA negatively of positively charged? Make sure to note that DNA is negatively charged - important for gel electrophoresis analysis later.

8. The DNA Alphabet How many nucleotide bases in DNA are there? 4
What are the names of these bases?
A, adenosine; T, thymine; G, guanine; C, cytosine
The sequence of these letters make up our genes. The Human Genome Project determined the order of each of these letters in all of our genes.
How many nucleotide bases are there?
What are the names of these bases?
Nucleotide bases are: adenine, thymine, cytosine, and guanine
ATCG
The sequence of these four letters make up our genes. The Human Genome Project determined the order of each of these letters in all of our genes.
reasons for establishing the human genome project
-to find disease-causing genes and possibly use the information to develop more specific treatments.
-The "genome" of any given individual (except for identical twins and cloned organisms) is unique; mapping "the human genome" involves sequencing multiple variations of each gene.
-All humans have unique gene sequences. Therefore the data published by the HGP does not represent the exact sequence of every individual's genome. It is the combined "reference genome" of a small number of anonymous donors.

9. How many bases are there in the human genome?
Facts & Figures about DNA
How many bases are there in the human genome?
3,000
300,000
3 million
3 billion
3 trillion
3000
300000
3 billion

10. How many bases are there in the human genome?
Facts & Figures about DNA
How many bases are there in the human genome?
3,000
300,000
3 million
3 billion
3 trillion
3000
300000
3 billion

11. Facts & Figures about DNA
We are not all exactly the same – What percent of your DNA is similar to any other person in the world?
99.9%
98%
90%
60%
10%
99.9
98 – Chimp
90 – mouse
60% - drosophila

12. Facts & Figures about DNA 3 MILLION bases are different!
We are not all exactly the same – What percent of your DNA is similar to any other person in the world?
3 MILLION bases are different!
99.9%
98%
90%
60%
10%
99.9
98 – Chimp
90 – mouse
60% - drosophila

13. Facts & Figures about DNA
Forensic scientists focus on these variable regions to generate a “DNA fingerprint” for each individual
A DNA Fingerprint is an individual's unique sequence of DNA base pairs
3,000,000,000 bases in the human genome!
Only 0.1% differs from one person to the next - see if they can figure out that this is 3,000,000

14. Review: how cells read the genome: from DNA to proteins
genotype
Describe how our genes translates into our characteristics (phenotype)
DNA is first transcribed to RNA. This RNA is then translated into proteins. The proteins give us our characteristics: eye color, hair color, skin color, etc.
Characteristics
(phenotype)

15. Eye Color This is a gene that helps to determine eye color
CACTCCTGGAGAAAGATCTGCAAGTGCGCAGAGAGAAGACTGGCAGTGGAGCATGCATCTGGAGGGCAGAGACGGCAGGCGGTACCCCGGCGCGCCGGCGGTGGAGCTCCTGCAGACGTCCGTGCCCAGCGGACTCGCTGAACTTGTGGCCGGCAAGCGCAGGCTTCCTCGGGGAGCCGGTGGAGCTGACCCCTCGCACTCCTGCCCCAGGGGGGCTGCCGGGCAGAGCTCTTGGGCTCCTGCAGGCCAGGAGTTTGCTTCATTCCTCACAAAAGGGAGGTCTCACTCTTCTTTGCCCCAGATGTCCAGCTCCAGGTCTAAAGATTCCTGCTTTACAGAAAACACTCCTTTGCTGAGGAATTCCTTACAGGAGAAAGGGTCACGGTGCATACCTGTTTACCATCCAGAGTTCATCACTGCTGAAGAGTCTTGGGAAGACAGCTCTGCTGACTGGGAGCGAAGATACCTGCTAAGCAGGGAGGTGTCTGGTCTGTCTGCATCTGCCTCCTCCGAGAAGGGAGACCTTCTGGACAGCCCGCACATCCGACTCCGTCTTTCCAAGCTGAGGCGCTGTGTGCAGTGGCTGAAAGTCATGGGCCTGTTTGCCTTTGTGGTGCTGTGTTCTATTTTGTTCAGCCTATATCCGGATCAAGGAAAGCTCTGGCAGCTGTTGGCCTTATCACCGCTGGAGAACTACTCCGTGAACCTTAGCAGCCACGTGGACTCCACGCTGCTGCAGGTGGACCTGGCAGGGGCCCTAGTGGCCAGTGGGCCGAGTCGTCCTGGGAGGGAAGAGCACATCGTGGTGGAGCTGACCCAGGATGACGCTTTGGGCTCCAGGTGGCGGCGGCCACAGCAGGTCACTCACAACTGGACGGTGTATTTAAATCCGAGGAGAAGCGAGCACTCAGTGATGAGCAGGACCTTTGAGGTACTGACCAGAGAGACGGTGTCCATCAGCATCCGGGCCTCCCTGCAGCAGACCCAGGCTGTCCCTCTTTTGATGGCTCATCAGTACCTCCGCGAAGTGTAGAAACCCAGGTGACCATCGCGACGGCCATCCTCGCGGGCGTCTACGCGCTGATATATTTGAGATCGTGCACAGAACTCTGGCGGCCATGCTGGGTTCCCTTGCAGCACTGGCGCACTGGCTGTGATTGGCGATAGACCCAGCCTGACCCATGTGGTGGAGTGGATTGATTTTGGACGCTGGCCCTGCTGTTTGGCATGATGATCTTAGTAGCCATATTTTCAGAAACGGATTTTTCGATTATTGTGCTGTAAAGGCATACCGGCTCTCCCGGGGACGGGTGTGGGCCAGATCATCATGCTCTGTCTCATCGCGGCCGTCCTCTCTGCCTTCTTGGACAACGTCACCACATGCTCCTCTTCACGCCTGTGACCATAAGGTTGTGTGAGGTGCTCAACCTTGATCCAAACAAGTCCTGATTGCAGAAGTGATCTTCACAAACATTGGAGGAGCTGCCACTGCCATCGGGACCCTCCAAATGTCATTATTGTTTCCAACCAAGAGCTGAGGAAGATGGGCCTGGACTTGCCGGATTCACTGCACACATGTTCATTGGGATTTGCCTTGTTCTCCTGGTCTGCTTTCCCTCCTCAGACTCCTTTACTGGAACAGAAAGCTTTATAACAAGGAACCCAGTGAATTGTGAACTGAAGCACGAGATTCACGTCTGGCGCCTGACTGCTCAGCGCATCAGCCCGCCAGCCGCGAGGAGACAGCTGTGCGCCGCCTGCTGCTGGGGAAGGTGCTGGCACTGGAGCACCTGCTCGCCCGGAGGCTGCACACCTTCCACAGACAGATCTCACAGGAGGACAAAAATTGGGAGACCAATATCCAAGAACTCCAAAAAAAGCATAGGATATCTGACGGGATTCTGCTCGCCAAATGCCTGACAGTGTTGGGATTTGTTATCTTCATGTTTTTCCTCAATTCGTTTGTCCCTGGCATTCATCTTGATCTTGGATGGATTGCTATTCTGGGTGCCATCTGGTTGCTAATTTTAGCTGATATTCATGATTTTGAGATAATTCTACACAGAGTGGAATGGGCAACCCTTCTGTTTTTTGCAGCGCTCTTTGTTCTGATGGAGGCATTGGCACATCTCCACTTAATAGAATATGTTGGAGAACAAACTGCTTTGCTAATAAAGATGGTCCCAGAGGAGCAGCGCCTCATAGCCGCCATTGTCCTGGTGGTGTGGGTCTCAGCCCTGGCGTCGTCCCTGATTGACAACATCCCGTTCACTGCTACCATGATTCCCGTGCTCCTGAACCTGAGCCACGACCCTGAGGTTGGCCTGCCCGCACCGCCGCTCATGTATGCCCTGGCCTTCGGTGCTTGCCTGGGAGGCAACGGGACACTGATTGGCGCGTCGGCAAACGTCGTGTGTGCAGGGATTGCAGAACAGCATGGATATGGGTTCTCCTTCATGGAATTTTTCAGGCTGGGCTTCCCAATGATGGTTGTGTCCTGCACTGTTGGGATGTGTTATCTCCTTGTGGCTCATGTGGTGGTGGGATGGAATTAATAGACATCCATCTATTGCTCGAAGACTAAAGGAAACTTCATCCATCACAACCCATTAGTCATAAAACTACCCTGACCCCACTGTTTGAAGAAGAAAAGGTGCTTACCCTGGAGATGCTACAGAGACACAGTGGAATAGACCTTGACACTAACACTCTAATTCAAGCGAATGTTGGAACACCATGACCTCCTCTGTGTGTCCTTTCTCCCCAAGGACAAAATGTAGAAAGATGTGAGATAACTTACTCAAGATTCCCCTCCAGAAAAATACGTATGTTTAAAAACCCTTCCTGCTATACATAGGAAAAGACACACATCCACCTAAAATTGACTGTACTGTTTAACTGTCAATTCTCCTGAGGCTAAACACAGTTTGTTTTTCTTGTAATCACTTTTCATGTTAAAATAATCAGCATTCAAATTGTATGCTTTCTGAATATAGACTTTCTGGGAAAAGGTTTACTGCTCGTAAGGAAACATTTTATGTATTAAAATAAACTGT
This is a gene that helps to determine eye color
Have them take a guess at how many bps are there
For your info: quantitative-trait locus linked to the OCA2 region of 15q accounts for 74% of variation in human eye color.
Does anybody have green eyes

16. What are some sources of DNA?
Sweat
Skin
Blood
Tissue
Hair
Dandruff
Mucus
Semen
Ear Wax
Saliva
Urine
Ask them to name some sources of DNA and list them on the board before you show them this list.

17. Extracting DNA from a Human Sample

18. How do scientists study small amounts of DNA found at a crime scene?
PCR!
AP Biology Class: Please include the slide on PCR and use it to explain how just trace amounts of DNA found at a crime scene can be amplified by PCR analysis and used for DNA fingerprinting. Insert this slide between slides 7 and 8.
Alberts, B., et al. Molecular Biology of the Cell

19. PCR can make millions of copies of DNA in a short time
Alberts, B., et al. Molecular Biology of the Cell

20. Generating a DNA Fingerprint
DNA can be cut into smaller pieces by restriction enzymes that recognize very specific sequences of DNA.
AGCTAGAATTCTTTACGCTCGGATGAATTCCACCTATCTCC
Stress the Importance of this in forensic science
Describe restriction enzyme as chemical scissors.
Explain that we can use restriction enzymes to detect very small differences in the sequence of DNA between people.
AATTCCACCTATCTCC
AGCTAG
AATTCTTTACGCTCGGATG

21. Specific Enzymes Cut Specific Sequences
Hae III - cuts GGCC
6 Volunteers, please!
Use the letters, which are numbered in the bottom right corner, for a particular order.
Have 6 students volunteer to stand in front of the class to make a DNA strand.
Tell them that you are a restriction enzyme that will cut GG/CC (in between the G and C) and ask them where you should separate the students that would be cut by the enzyme. They will be separated into one of 4 base pairs and one of 2 base pairs.
Then ask them which of the DNA pieces would move most quickly through the gel, which would move most slowly? (2 moves farthest, 4 moves the least)
(You could demonstrate the ability of 4 students moving through a door all at the same time, verses 2 students moving through at the same time. 2 students should have an easier time moving through.)
Then move the order of students around so that the GGCC site is no longer thereand ask them if the restriction enzyme would cut. Emphasize that our genes are almost identical but we have very small changes in base pairs. These changes can be detected with restriction enzymes.
Stress that the site has to be exactly GGCC for your particular enzyme to cut it. It doesn’t cut anywhere there is a G followed by a C, but only when there is GGCC.
Have them tell you what the new sizes of DNA would be. If you’ve destroyed the site, the enzyme will no longer cut and therefore, still only 1 fragment of DNA would exist after the digest.

22. There are hundreds of restriction enzymes!
Each restriction enzyme recognizes a specific DNA sequence.

23. Analyzing the DNA on an Electrophoresis Gel
Gel electrophoresis is a technique used to separate molecules based on size
Describe gel electrophoresis as a jello with very tiny holes.
Larger objects have trouble moving through, but smaller ones can move more easily. One suggestion is comparing it to moving through the hallways as classes are changing – its very congested, but the little guy that is smaller than everyone else can move through more easily.
Also point out the marker that is used for estimating the size of your DNA. Sometimes you know what sizes to expect, other times you need to use the marker to figure it out.
An agarose gel is used to analyze the DNA. This gel is a matrix and feels like jello.

24. Analyzing the DNA on an Electrophoresis Gel
marker
Sample 1
Sample 2
Sample 3 _ M 36 24 18 10 7 2 +
Describe gel electrophoresis as a jello with very tiny holes.
Larger objects have trouble moving through, but smaller ones can move more easily. One suggestion is comparing it to moving through the hallways as classes are changing – its very congested, but the little guy that is smaller than everyone else can move through more easily.
Also point out the marker that is used for estimating the size of your DNA. Sometimes you know what sizes to expect, other times you need to use the marker to figure it out.
Marker is loaded in the first lane. Samples are loaded in the rest of the lanes of the gel.
Electric current is applied and the negatively charged DNA moves towards the positive end of the gel.
The DNA has to move through the small openings in the matrix of the gel. Which sizes move fastest through the gel?
An agarose gel is used to analyze the DNA. This gel is a matrix and feels like jello.

25. Analyzing the DNA AGCTAGAATTCTTTACGCTCGGATGAATTCCACCTATCTCC _M _ 35 25 20
AATTCTTTACGCTCGGATG (19) 18
AATTCCACCTATCTCC (16) 14
This is the same sequence we looked at just a minute ago.
The DNA was cut into 3 pieces of 6, 19, and 16.
If we were to run this DNA on a gel, the pattern would look like this, with the smallest fragment moving the fastest, and the larger fragment moving the slowest.
Make sure they understand the separation by size. 12 8
AGCTAG (6) +

26. Who Did It? Practice Solving the Crime 1 2 3 4
marker
Crime scene 1 2 3 4
Who Did It?
Practice 35 25 20
Because of variations in our DNA sequence, every person has a unique restriction digest pattern, allowing DNA from a crime scene to be matched to a particular suspect. 18 14
Point out the marker on the gel as well as the crime scene DNA. Ask them which suspect committed the crime by matching the DNA pattern to the crime scene. 12 8

27. Who’s the father?

28. CONFIDENTIAL Missing Falcon!
Objective: The DNA analyst has been working night and day to get through the countless samples, but hasn’t found the captor. She is exhausted and has therefore decided to go on strike.
Principal Leathers is impatient to identify the thief and retrieve your beloved mascot.
He has therefore asked your class to help finish data analysis.
Only samples from the following students remain.

29. The Suspects Will, Captain of the Football Team Liza, Head Cheerleader
Jude,
Senior Class
President
Natalie,
Valedictorian
Molly,
Rival High
Homecoming
Queen
Maggie,
Lead actress
in school play
Vince,
Drum Major

30. Restriction Enzyme Digestion Analysis
EcoRI cuts the following sequence:
G|AATTC
Find all EcoRI cut sites in the DNA sequence of the suspect you represent
Draw the bands on the gel according to their predicted lengths following digestion
This slide explains what each student should do for this activity.
Activity:
Pass out a suspect sheet to each student.
Have each student go through and find all the EcoRI cut sites, determine the size of each fragment, and draw the DNA pieces on the gel.
Have the students with the same suspect get together and compare their EcoRI digestion analysis.
Have one representative from each group go to the poster board and draw their digestion pattern on the gel.
Identify the thief as a class.

31. TCGATGAATTCTATCGGAATTCTCGGACTTCTCGAGAATTCTGCGGATTTCTCGGATTCA
Suspect #1: Will
DOB: 07/11/1995
Sex: Male
Weight: 220 lb.
Height: 6’1”
Position: Captain of the Football Team
DNA Sequence:
TCGATGAATTCTATCGGAATTCTCGGACTTCTCGAGAATTCTGCGGATTTCTCGGATTCA
DNA Fragment Sizes: _________________ 1 35 30 28 24 20 16 10 12 5 M
Thief 6,
11,
19, 24
These slides contain the suspect information sheets. You have handouts for each student in the class.
Note: the EcoRI cut site is located in the lower right hand corner for reference.
EcoRI: G|AATTC

32. Who did it?
These slides contain the template for the agarose gel that the students can fill in if an overhead projector is being used.
Use template drawn on poster board

33. 35 30 28 24 20 16 12 10 5 1 Crime Scene DNA Suspect #2: Natalie
Suspect #1: Will
Suspect #3: Molly
Suspect #4: Jude
Suspect #5: Maggie
Suspect #6: Vince
Suspect #7: Liza
DNA Ladder 35 30 28 24 20 16 12 10 5 1

34. Suspect #2: Natalie
Crime Scene DNA
Suspect #1: Will
Suspect #3: Molly
Suspect #4: Jude
Suspect #5: Maggie
Suspect #6: Vince
Suspect #7: Liza
DNA Ladder 35 30 28 24 20 16
These slides show the correct DNA fragments for each suspect all on the same agarose gel, and allow for students to identify Vince as the thief. 12 10 5 1

35. The thief is…
Thanks young geniuses!! Soar high Falcons!!
Vince

36. Some afterthoughts…
Do you think that it is fair that students are required to submit a DNA sample simply because they are a member of the Senior class? On what basis should people be required to submit a DNA sample in a criminal investigation?
What are some potential sources for error in such an investigation? Keeping these in mind, do you think that DNA fingerprinting alone provides substantial enough evidence for positive identification of a criminal?
This slide presents some questions for discussion, if time permits.
Invite students to share their thoughts on these issues, keeping in mind that everyone’s opinion is valid.

37. DNA testing is helping to exonerate innocent people…
Organization dedicated to exonerating wrongfully convicted people through DNA testing.
9 people in the state of NC have been exonerated thanks to DNA testing
Think about some discussion points for the ethical, legal, and social issues of DNA testing. Included are questions that are meant to engage students if time allows. Please go to the website for the Innocence Project in order to be familiar with it. Other topics to think about are public access to DNA databases, how insurance companies, potential employers, landlords, etc may use this information against someone. You may also want to make the point that fingerprint databases do not include everyone, so why should DNA databases include everyone?

38. DNA databases can be helpful in solving crimes
DNA databases can be helpful in solving crimes. The Innocence Project supports the maintenance of a DNA database from convicted felons only.
Why do you think this is the case?
Do you think DNA databases should include everyone?
Who do you think should have access to information on people’s DNA?
How could someone’s DNA be used for purposes other than to solve a crime?

39. Genetic Engineering
The process of making changes in the DNA code of living organisms
Transformation
A cell takes in DNA from outside the cell and makes it part of its DNA.

40. Transformation is when a cell takes in DNA from outside the cell
Transformation is when a cell takes in DNA from outside the cell. This DNA becomes part of the cell’s DNA. This can be accomplished with the help of bacteria.

41. Transgenic Organisms
Microorganisms, animals, and plants that contain genes from other organisms.
Also called GMO’s (Genetically modified organisms)
Image copyright Reuters 2003

42. Undernourished people in poorer countries may have blindness caused by a lack of vitamin A
So, genes for making beta-carotene are taken from daffodils and inserted into the genome of rice
Now, golden rice contains beta-carotene, which forms Vitamin A
Golden Rice

43. Recombinant Bovine Growth Hormone
rBGH is a genetically engineered version of a hormone, which is found in the pituitary gland of cows and controls milk production
rBGH can increase cows’ milk production by as much as 20-30%

44. Gene Cloning for pharmaceutical applications: Production of Human Insulin
Insulin regulates the blood sugar level.
The gene for human insulin is inserted into yeast or bacteria, from which large quantities of the human insulin are manufactured

45. Arguments Against Genetically Modified Food
Effects not fully understood
Genes can mutate with harmful effect
Could have impact on birds, insects, and soil
Potato game
No one knows effect of GM pollen on bees digestive tracts

46. Farming Game!

47. Instructions
Draw 15 ovals on a sheet of paper – these are your sweet potatoes on your farm.
Choose 3 genetic modifications for your potatoes that you think will help them to best survive. Write these down on your paper.

48. May: Planting
There is a late-season frost at the end of the May. If you did not choose the anti-freeze gene, you lose 3 potatoes.
The neighboring lettuce farmer offered to lease your fields to double his early summer lettuce crop. If you bought seed for potatoes for a shorter growing season, you are able to lease him your land and still plant your own sweet potato crop in late June. Add 4 potatoes.

49. June - September: Growth
It’s been a bad year for potato farmers. Many farms have been overtaken by caterpillars that eat anything green in sight. If you didn’t choose the Bt-modified potatoes, you lose 4 potatoes.

50. June - September: Growth
It’s been a very windy year, leading to greater amounts of weed seed dispersal. Weeds are threatening to overtake your farm, and you need to spray Round-up to get the problem under control. If you do not have Round-up ready sweet potatoes, lose 3 potatoes.

51. June - September: Growth
North Carolina is experiencing a severe drought. If you bought drought resistance sweet potatoes, add 5 potatoes.

52. June - September: Growth
Your farm has not been bothered by weeds, but your neighbor’s has been overrun with weeds. Your neighbor sprayed Round-up and it affected non Round-up ready plants on your farm. If you do not have Round-up ready sweet potatoes, lose 1 potato.

53. June - September: Growth
There is a root-knot nematode infestation on your farm. If you did not grow sweet potatoes that were resistant to the parasite, lose 3 potatoes.

54. June - September: Growth
There was no sweet potato virus disease this year in North Carolina. If you paid extra for SPVD-resistance potatoes, it didn’t pay
off. Lose 1 potato.

55. October - January: Sales & Storage
Overseas sales of products with high levels of vitamin C skyrockets. You can double your asking price if you grew sweet potatoes with enhanced levels of vitamin C. This lets you buy more seed for next year. Add 3 potatoes.
A new report on the prevention of cancer came out indicating vitamin A as the most important component of a cancer-prevention
diet. If you grew sweet potatoes with enhanced levels of B-carotene, the precursor for vitamin A, you can sell your potatoes at an
increased profit. Add 4 potatoes.
High protein diets are back in vogue. If you are growing sweet potatoes with increased protein content, add 2 potatoes.
McDonalds has decided to sell sweet potato fries. As a mass food producer, they are only interested in getting as many fries per
potato as possible. If you bred for increased size, add 3 potatoes.
Martha Stewart has come up with a new sweet potato dish to celebrate Memorial Day. Regular sweet potatoes only last until
March. If you grew sweet potatoes that were bred for a longer shelf life, add 2 potatoes.
Ben & Jerry’s started to make sweet potato ice cream. If you are growing sweet potatoes with enhanced sweetness, they will pay
double for your crop. Add 4 potatoes.
Blue sweet potatoes do not sell. Parents are concerned that the blue color is related to an outbreak of the vaccine-resistant measles.
If you are growing blue sweet potatoes, lose 6 potatoes.

56. October - January: Sales & Storage
A new report on the prevention of cancer came out indicating vitamin A as the most important component of a cancer-prevention diet. If you grew sweet potatoes with enhanced levels of B-carotene, the precursor for vitamin A, you can sell your potatoes at an increased profit. Add 4 potatoes.
High protein diets are back in vogue. If you are growing sweet potatoes with increased protein content, add 2 potatoes.
McDonalds has decided to sell sweet potato fries. As a mass food producer, they are only interested in getting as many fries per
potato as possible. If you bred for increased size, add 3 potatoes.
Martha Stewart has come up with a new sweet potato dish to celebrate Memorial Day. Regular sweet potatoes only last until
March. If you grew sweet potatoes that were bred for a longer shelf life, add 2 potatoes.
Ben & Jerry’s started to make sweet potato ice cream. If you are growing sweet potatoes with enhanced sweetness, they will pay
double for your crop. Add 4 potatoes.
Blue sweet potatoes do not sell. Parents are concerned that the blue color is related to an outbreak of the vaccine-resistant measles.
If you are growing blue sweet potatoes, lose 6 potatoes.

57. October - January: Sales & Storage
High protein diets are back in vogue. If you are growing sweet potatoes with increased protein content, add 2 potatoes.
McDonalds has decided to sell sweet potato fries. As a mass food producer, they are only interested in getting as many fries per
potato as possible. If you bred for increased size, add 3 potatoes.
Martha Stewart has come up with a new sweet potato dish to celebrate Memorial Day. Regular sweet potatoes only last until
March. If you grew sweet potatoes that were bred for a longer shelf life, add 2 potatoes.
Ben & Jerry’s started to make sweet potato ice cream. If you are growing sweet potatoes with enhanced sweetness, they will pay
double for your crop. Add 4 potatoes.
Blue sweet potatoes do not sell. Parents are concerned that the blue color is related to an outbreak of the vaccine-resistant measles.
If you are growing blue sweet potatoes, lose 6 potatoes.

58. October - January: Sales & Storage
McDonalds has decided to sell sweet potato fries. As a mass food producer, they are only interested in getting as many fries per potato as possible. If you bred for increased size, add 3 potatoes.
Martha Stewart has come up with a new sweet potato dish to celebrate Memorial Day. Regular sweet potatoes only last until
March. If you grew sweet potatoes that were bred for a longer shelf life, add 2 potatoes.
Ben & Jerry’s started to make sweet potato ice cream. If you are growing sweet potatoes with enhanced sweetness, they will pay
double for your crop. Add 4 potatoes.
Blue sweet potatoes do not sell. Parents are concerned that the blue color is related to an outbreak of the vaccine-resistant measles.
If you are growing blue sweet potatoes, lose 6 potatoes.

59. October - January: Sales & Storage
Martha Stewart has come up with a new sweet potato dish to celebrate Memorial Day. Regular sweet potatoes only last until March. If you grew sweet potatoes that were bred for a longer shelf life, add 2 potatoes.
Blue sweet potatoes do not sell. Parents are concerned that the blue color is related to an outbreak of the vaccine-resistant measles.
If you are growing blue sweet potatoes, lose 6 potatoes.

60. October - January: Sales & Storage
Ben & Jerry’s started to make sweet potato ice cream. If you are growing sweet potatoes with enhanced sweetness, they will pay double for your crop. Add 4 potatoes.
Blue sweet potatoes do not sell. Parents are concerned that the blue color is related to an outbreak of the vaccine-resistant measles.
If you are growing blue sweet potatoes, lose 6 potatoes.

61. October - January: Sales & Storage
Blue sweet potatoes do not sell. Parents are concerned that the blue color is related to an outbreak of the vaccine-resistant measles. If you are growing blue sweet potatoes, lose 6 potatoes.

62. Potato Game Wrap up Who has the most potatoes left?
Did anyone lose their entire crop?
What are the positives and negatives of some of the insertions and why choosing is such an important and challenging investment?
Why do you think some farmers opt out of genetic modifications entirely?