1. Molecular Biology lecture -Putnoky
PRC
Polymerase chain reaction
Kary Mullis
Molecular Biology lecture -Putnoky

2. Molecular Biology lecture -Putnoky
Components of a PCR reaction
1) template DNA
2) dATP, dCTP, dGTP, dTTP (dNTPs)
3) heat stable DNA polymerase (Taq polymerase)
4) two oligonucleotide primers
In a PCR reaction a section of a DNA bordered by two primer sequences will be multiplied in several consecutive synthesis cycles.
The PCR cycle
1. denaturation 94 oC - separation of the complementes DNA strands
2. annealing oC - hybridization of the primers to template
3. extension oC synthesis of the new tstrands
30-35 repeated cycles
The two primers hybridize to opposite strands of the DNA and direct the DNA synthesis toward the opposite primer site.
5’GACACCATCGAATCACGCAAAACCTTTCGCGGTATGGCA— N --CAATTCAGGGTGGTGAATGTGAATGTCAGTAACGTTATACG 3’
3’CTGTGGTAGCTTAGTGCGTTTTGGAAAGCGCCATACCGT— N --GTTAAGTCCCACCACTTACACTTACAGTCATTGCAATATGC 5’
denaturation and annealing
ACAGTCATTGCAATATGC 5’
5’GACACCATCGAATCAC
forward primer: 5’GACACCATCGAATCAC 3’ 16-mer, Tm= 54,3 °C
reverse primer: 5’CGTATAACGTTACTGACA 3’ 18-mer, Tm= 54,2 °C
Molecular Biology lecture -Putnoky

3. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

4. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

5. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

6. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

7. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

8. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

9. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

10. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

11. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

12. Molecular Biology lecture -Putnoky
2 (8)
Molecular Biology lecture -Putnoky

13. Molecular Biology lecture -Putnoky
8 (22)
Molecular Biology lecture -Putnoky

14. Molecular Biology lecture -Putnoky
22 (52)
Molecular Biology lecture -Putnoky

15. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

16. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

17. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

18. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

19. Molecular Biology lecture -Putnoky
A PCR program
min 94 °C
sec 94 °C
sec 56 °C - depends on the sequences of the primers
sec 72 °C - depends on the lenght of the amplified DNA (60 nt/sec)
x GO TO 2.
6. end
Primer design
1. Melting temperature (Tm) of the two primer should be similar
Tm = 4x(G+C) + 2x(A+T)* Ta= Tm ± (2-5 °C) °C
2. strong secondary primer structure disturbs reaction (formation of hairpins and primer dimers)
3. the length of the product is limited (300 to 3000 bps) Over 10 kb
Sevaral programs available to assist for primer design:
primer hairpins
primer dimers
Molecular Biology lecture -Putnoky

20. Molecular Biology lecture -Putnoky
Processivity
The Taq DNA polymerase lacks a 3′–5′ proofreading exonuclease activity. Therefore it makes more frequenty errors during amplification. To overcome this problem, other thermostable DNA polymerases with improved fidelity can be used. For example the Pfu polymerase from Pyrococcus furiosus is eight times more accurate than Taq polymerase. Now, genetically modified Pfu-like enzymes are also available which carry an additional processivity-enhancing domain. They can be 50-times more accurate than Taq polymerase.
After PCR amplification it is important to check the nucleotide sequence of the cloned product.
The maximum length of the amlified DNA is limited. In a conventional PCR reaction only a bp product can be amplified effectively. Using high fidelity enzyme and special tricks maximum a 10 kb product can be amplified.
Although PCR is a very effective method to clone (multiply) short DNA fragments, the only way to isolate large DNA sections from a genome is the preparation of a genomic library.
Comparision of the yield of different enzymes
Amplification products 160 bp, 727 bp, 2 kb, or 5 kb from human genomic DNA
Molecular Biology lecture -Putnoky

21. Molecular Biology lecture -Putnoky
PCR applications
1) cloning – isolation of a DNA sequence without a genomic library
2) isolation and detection of mutations: prenatal diagnosis by using small samples of fetal tissue
3) heterologous or degenerate primers can be used to clone sequences from related species
4) gene manipulation – introduction of additional restriction sites for cloning
5) introduction of a mutation
6) Cloning and sequencing ancient DNA samples
7) forensic appications - DNA profiling, DNA typing, genetic fingerprinting
8) genetic mapping by DNA markers – RAPD, random amplified polymorfic DNA
9) hybridization or PCR
10) mRNA cloning and detection of gene expression - RT-PCR, real time PCR
Molecular Biology lecture -Putnoky

22. Molecular Biology lecture -Putnoky
DNA fingerprint
microsatellite or simple sequence repeat (SSR) regions
repeat sequences flanking by unique sequences
usually non-coding regions
parental alleles are usually different from each other
examination of several regions makes possible the identification of a given person
Molecular Biology lecture -Putnoky

23. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

24. Molecular Biology lecture -Putnoky
Molecular Biology lecture -Putnoky

25. Molecular Biology lecture -Putnoky
100 bp
ladder
500 bp
600 bp
700 bp
800 bp
400 bp
lambda
PstI
Experiment from the Molecular Biology Laboratory
separation: agarose gel
the resoluton is not so good as in a polyacrilamyde gel
see details in the practical guide
Molecular Biology lecture -Putnoky