1. Do Now Question
If there was a chance you inherited a genetic disease (but did not yet have it) and a genetic test for the disease was available, would you want to be tested for the disease or not? Explain your choice in 3-5 sentences.

2. Genetic Diseases
Ms. Bush
Genetics Unit

3. Autosomal Genetic Diseases

4. Cystic Fibrosis An autosomal recessive disease (chromosome 7)
Results in abnormal mucus build-up in the lungs
More common in people of European decent

5. Cystic Fibrosis

6. Sickle Cell Disease Autosomal recessive disease (chromosome 11)
Causes red blood cells to be sickle shaped
Most common in people of African decent

7. Sickle Cell Disease

8. Tay Sachs Autosomal recessive disease (on chromosome 15)
Nervous system disease
Causes deafness, blindness, muscle tone loss, delayed mental and social skills
1 in 27 of Ashkenazi Jewish people have disease
Also common in people of Cajun and French Canadian ancestry

9. Phenylketonuria (PKU)
Autosomal recessive (chromosome 12)
People with PKU cannot break down phenylalanine
Causes delayed mental and social skills if not detected early
All newborns in US screened for PKU
Phenylalanine (amino acid)

10. Huntington’s Disease Autosomal dominant (chromosome 4)
Nerve cells degenerate
Late onset (30s-40s)
Caused by CAG repeats in DNA
50% of children will inherit this disease if one parent has it
CAGCAGCAGCAGCAGCAGCAGCAG

11. Sex-linked Genetic Diseases
XY XX

12. Hemophilia A genetic disease that is carried on the X chromosome
This disease prevents blood from clotting
In severe cases, it can cause death by excessive bleeding

13. Famous Example of Hemophilia

14. Duchenne Muscular Distrophy
Causes continual degeneration of muscles
Recessive X-linked disease
Diagnosed between ages 2-6
Few survive beyond age 30

15. Pedigrees