1. Animal Development Drosophila axis formation Part 1: A-P patterning
Part I introduces Drosophila development, the life cycle, terminology and tissues. Oogenesis and early embryogenesis. The role of maternal and zygotic gene expression is discussed. There is a overview of the hierarchy of genes controlling anterior-posterior patterning and segmentation. This introduces the practical that follows in TT.
The core part of this lecture is concerned with dorsal-ventral patterning, the different signals that establish asymmetry in the embryo and some of the mechanistic principles underlying these pathways. A recurring theme is how different signalling pathways may be recruited to different developmental processes both in Drosophila and in vertebrates.
Synopsis: Review of Drosophila life cycle, terminology and tissues. Maternal and zygotic gene expression. Origin of the asymmetry and localised determinants in the egg. Subdivision and specification of the embryonic pattern. Transcriptional and translational regulation in embryogenesis. Where to study signal transduction pathways.

2. In this lecture: The origin of Anterior-Posterior Axis
Mutant screens to isolate segmentation genes
Genetic analysis of early acting determinants
Important roles of post-transcriptional regulation and mRNA/protein localisation
Methods of dissecting enhancers
Dosage-dependent activation of zygotic genes
Hierarchical organisation of segmentation genes

3. THEY LIVE….

4. 1 * egg: generate the system * larva: eat and grow
Developmental biology:
Drosophila segmentation and repeated units
* egg: generate the system
* larva: eat and grow
* pupa: structures in
larvae grow out to form
adult fly: metamorphosis
(Drosophila is a
holometabolous insect) 1

5. The early embryo is a syncitium
The unusual feature of the Drosophila early embryo is that the first 13 mitoses are nuclear divisions without concomitant cytoplasmic division, making the embryo a syncitium-a multinucleated cell. After division 9, the plasma membrane of the oocyte evaginates at the posterior pole to surround each nucleus thus creating the pole cells, which will form the fly’s germ line.

6. Segments in embryos are maintained throughout development

7. Forming complex pattern: establishing positional information

8. The Hunt for Mutants
30,000 independently-derived mutants in genes required for survival.
8,000 mutants define genes required for embryonic survival (these became the focus the study).
750 mutants have specific effects on A/P or D/V patterning.
150 genes with specific effects on A/P or D/V patterning identified by the 750 mutants (average of ~ 5 alleles per gene).

9. A Detour Into Embryonic Anatomy – Denticle Bands
Denticle bands on a 1st instar larva.
Denticle bands are hair-like projections on the ventral cuticle of an embryo.
Denticle bands provide an easily visualized marker of embryonic/larval pattern.

11. Maternal effect genes
Phenotype of the embryo is determined by the genotype of the mother.
The polarity and spatial coordinates of the embryo are initially set by the products of these genes (therefore, sometimes called “coordinate genes”).
The gene products, either mRNA transcripts, proteins, or cell surface ligands are contributed by the nurse cells or follicle cells as the egg is constructed.
The dorsal-ventral axis (1 gene-system, 12 genes) and anterior-posterior axis (3 gene-systems; anterior, 4 genes, posterior, 11 genes, and terminal, 6 genes) determined by maternal effect genes.
Originally isolated as homozygous mutant, adult females that lay normal looking eggs that do not develop at all, regardless of the genetic contribution of the male.

12. Four Independent Genetic Regulatory Systems Specify the Anteroposterior and Dorsoventral Axes

13. Maternal effect genes All four systems share several properties:
(i) the product of (at least) one gene is localized in a specific region of the egg,
(ii) this spatial information results (directly or indirectly) in an asymmetrical distribution of a transcription factor,
(iii) the transcription factor is distributed in a concentration gradient that defines the limits of expression of one or more zygotic target genes, such as segmentation genes.

14. Establishment of AP axis in oogenesis and bicoid localisation by Gurken signalling.
In early stage egg chambers MTOC is in the oocyte, and gurken mRNA is localised at posterior.
Translation and limited diffusion means signal sent to overlying posterior follicle cells (received via torpedo receptor).
A signal is sent back which activates protein kinase A in the egg
oocyte cytoskeleton is re-organised and directs the localisation of bicoid and oskar, defining the A-P axis.

17. Bicoid mutant embryos lack head and thorax structures
bicoid/bicoid
mother
+/+
mother

19. Effect of replacement of the 3’ UTR of the nos mRNA with the 3’ UTR of bcd mRNA
The nos-bcd transgene is able to localise at the anterior pole and as a consequence NOS protein will inhibit translation of the hb and bcd mRNAs.

20. The Bcd gradient
mRNA (in situ)
Protein (Ab staining)

21. Concentration gradients of BCD and HB-M establish A-P axis
Positional information along the A-P axis of the syncitial embryo is initially established through the creation of concentration gradients of two transcription factors: Bicoid (BCD) and Hunchback (HB-M). These are products of two maternal effect genes their mRNAs provided by the mother and stored in the embryo until translation initiates. These factors interact to generate different patterns of gene expression along the axis.

22. Bicoid is an Anterior Morphogen
Note that bicoid (and other maternal effect gene products) diffuse in the shared cytoplasm of the syncytial blastoderm.
This is a unique feature of insect embryogenesis.

23. BCD acts as a concentration-dependent manner

24. Thresholds can turn gradients into sharp boundaries
Bicoid protein required for early activation of zygotic hunchback.
Bicoid contains homeobox
Mutations in homeobox results in failure of Bicoid protein to interact with hunchback target sequences.

25. bicoid protein gradient
gradient is interpreted at least at four different levels (thresholds).

26. bicoid as a repressor of posterior fates
Bicoid binds the 3’ UTR of caudal mRNA and suppresses translation.
Caudal protein enters the nuclei at the posterior end of the syncytial blastoderm and helps specify posterior fates
Caudal protein

27. At the Posterior: nanos localisation by Gurken signalling
oocyte cytoskeleton is re-organised and directs the localisation of bicoid and oskar, defining the A-P axis.
oskar mRNA binds Kinesin I and Staufen proteins.
Kinesin I localises oskar mRNA to posterior
Staufen allows translation of oskar mRNA
Oskar protein binds nanos

28. Effect of posterior group genes on hunchback.
primary gene is nanos.
nanos mRNA is tightly localised to the posterior pole of the egg.

29. Effect of posterior group genes on hunchback.
The role of nanos is to disable hb maternal mRNA at the posterior end of the egg.

30. Four Independent Genetic Regulatory Systems Specify the Anteroposterior and Dorsoventral Axes

31. Terminal group genes

32. Torso: TRK signalling via MAPK

33. Segmentation pattern
Obvious segmentation begins to develop by germ band extension stage.
The embryonic segmentation pattern has direct analogs to the final segments of the adult.
Segmentation pattern can be thought of as classical segments or midsegment-to-midsegment intervals called parasegments.
Some early embryonic segments become incorporated into the complex structures of the head and mouth.

34. The mutant phenotype tells us where the gene is normally required

35. Segmentation genes
The segmentation genes form a cascade of transcription factor gene expression.
The genes use positive and negative regulation to generate the pattern of striped expression.
The pattern is established very early in development (i.e. even before the cells “look different”), and determines the fate of specific cells.
Many of the genetically defined interactions have also been shown to have direct molecular interaction.
While the gap and pair-rule genes do not seem to act after gastrulation, their appearance has permanently stamped positional values on the cells.

36. hunchback gene hunchback
As well as maternal it is also a Gap gene (zygotic)
contains zinc finger domain homologous to TFIIIA (transcription factor in Xenopus)
hunchback deletion in zygote - gnathal and thoracic segments deleted.

37. 5 binding sites for bicoid in the hunchback promoter
genomic
B A
2.9kb zygotic
transcript 5’ 5’
3.2kb maternal
transcript
B1 TTTTACTTTATTAATTCATGCTAATCTGATGACTG...
B2 ATTCTATCTCATAATCACCTTTAATCCCAAGTACT...
A1 TGCTGTCGACTCCTGACCAACGTAATCCCCATAGAA...
A2 CATAATTTTTTGTTTCTGCTCTAATCCAGAATGGA...
A3 CTTCCCGTCACCTCTGCCCATCTAATCCCTTGACGC
Consensus = TCTAATCCC

38. 123bp of hunchback promoter needed for correct spatial expression of hunchback.

39. Patterns of Gap Gene Expression
Hunchback expression is controlled by bicoid.
Hunchback is the master gap gene.
Hunchback and bicoid together control other gap genes.

40. The Hunchback Gradient Controls the Expression of Other Gap Genes

41. Maternal Coordinate Genes
A Gene’s Sphere of Influence Extends Only To Where Its Product is Expressed
Maternal Coordinate Genes
bicoid (bcd)
caudal (cad)
hunchback (hb)
nanos (nos)
hunchback (hb)
Krüppel (Kr)
knirps (kni)
giant (gt)
tailless (tll)
Gap Genes
Pair-Rule Genes
even-skipped (eve)
odd-skipped (odd)
hairy (h)
runt (run)
fushi-tarazu (ftz)
paired (prd)
Segment Polarity Genes En
engrailed (en)
wingless (wg)

42. Pair-Rule Genes Are Expressed in Alternating Segment-Width Bands
Eve (gray) and ftz (brown) expression patterns.

43. Enhancer trapping in Drosophila
Use transposon P element
Carries reporter gene e.g.
b-galactosidase
Hops into genome
When lands near enhancer, activates gene expression
Expression similar to that of neighboring gene
P element recognition sites
TATA
b-galactosidase
P element vector
enhancer
gene Y
enhancer
b-galactosidase
gene Y

44. Regulation of eve stripes 3 and 7
eve 1 to 7
eve 1 and 7
hb-Z
kni

45. Transcription Factors and Their Binding Sites in the eve Stripe 2 Module
Determine binding sites by footprinting
Note that these transcription factors are the products of patterning genes higher in the regulatory hierarchy to eve.
Determine importance of enhancer elements by mutagenesis.

46. Regulatory
Protein Gradients That
Control
the Eve
Stripe 2
Module
The sharp Hunchback (green) and Kruppel (red) expression boundary.

47. Interaction Between Gene Products Sharpens
Expression Boundaries
early
late
Sharpening eve-ftz stripes.
Autoactivation and mutual inhibition of the eve and ftz transcription factors
Ftz
Eve

48. Regulatory
Gene Cascades
and Interactions-
Segment Polarity Genes

49. Mutations of Segment Polarity Genes Often Cause Mirror Image Duplications of a Portion of Each Segment

50. Segment Polarity Genes Are Expressed in a Portion of Each Segment
Once activated, segment polarity gene expression persists in the embryo and adult.
Expression of engrailed in the embryo and adult.

51. Summary Initial asymmetry for AP axis set up during oogenesis
Pattern organised by maternal proteins soon after fertilization
Localised maternal proteins activate or repress zygotic genes
Transcriptional and post-transcriptional regulation
Gradients of transcription factors are refined by mutual activation and repression and cell-cell signalling.

52. Footnote: Transgenes in P-elements are used to transform flies
Gene of interest is inserted into P-element vector with w+ marker
Transformation plasmid is mixed with helper plasmid encoding transposase
The mixed DNA is injected into the posteriors of w- embryos (where germline cells develop)
The mobilized P-element will insert ~ randomly into the genome
Transformed adults carrying the w+ marker will have red eyes