Download presentation
Presentation is loading. Please wait.
Published byCornelia Fuhrmann Modified over 6 years ago
1
Department of Zoology, Banaras Hindu University Varanasi 221005, India
A possible role of Oxytocin on spermatogenesis and steroidogenesis in mouse: An approach towards development of precocious puberty Speaker: Dr. Shabana Anjum (Ph.D.) Department of Zoology, Banaras Hindu University Varanasi , India
2
General concept of Hypothalamic–Pituitary-Testicular axis
LH FSH GnRH Gonadotropins Spermatogenesis Steroid Production Anterior Pituitary H GnRH is primary regulator of gonadotropins (LH and FSH) secretion A hypothalamic decapeptide factor, known as Gonadotropin Releasing Hormone (GnRH) was discovered in brain of mammals OXT-receptor are present on GnRH neuron and Oxytocin modulate the GnRH release from the hypothalamus (Caligioni et al., 2007) P Posterior Pituitary Oxytocin Feed back loop T Testosteroneee Estradiol
3
OXYTOCIN Oxytocin is a neuro-peptide, produced by the Paraventricular nucleus (PVN) of the hypothalamus and released from the posterior pituitary It is nanopeptide with disulphide bridge Traditionally known as female hormone, where it regulate uterine contraction, milk ejection and parturition In male, OXT modulate sexual behavior, ejaculation and seminiferous tubule contraction that help in transfer of sperm to epididymis
4
Hypothalamic OXT Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Lec-Gly-NH2 Extra Hypothalamic OXT Ovaries Testes ? ? ? ? Testis Molecular mechanism by which OXT affect testicular steroidogenesis is not yet known
5
How it is regulating Steroidogenesis??
Is there any role of OXT in Spermatogenesis and Steroidogenesis??
6
Objective of my study Role of OXT on steroidogenesis and spermatogenesis Regulation of OXT through Luteininzing hormone
7
ELISA for Testosterone Steroidogenic factors Spermatogenic Factors
Experimental design Syntocinon/OXT In vivo Serum Testis ELISA for Testosterone Steroidogenic factors Spermatogenic Factors (N=8 per groups) In vitro (N=3 per groups) Testes was cultured for 24 hour in culture medium (DMEM + Ham’s F-12 Culture medium Testis Steroidogenic factors ELISA for Testosterone Group (1): Control Group (2): 0.25 IU/BW (Low) OXT Group (3): 1.0 IU/BW (High) OXT For 8 days I.P. On 28th day of postpartum Group A: (1) Control; (2) 0.05 IU/mL OXT; (3) 10 ng/mL LH (4) 10 ng LH+0.05 IU OXT
8
Effect of OXT on testosterone level in serum and 3β HSD enzyme activity in testis
(ng/mL) Dose of OT (IU/day/BW) 0.25 1.0 - + b a (A) c (B) 3 β HSD Enzyme Activity (n mol NADH/hr/mg of protein) b a Dose of OT (IU/day/BW) 0.25 1.0 - + Figure 1
9
1.0 IU (OT) 0.25 IU (OT) Control (OT)
Effect of OXT on histological study in testis (in vivo) (A) (B) (C) rSt rSt rSt p Sc p Sc pl S p Sc SC pl Sc SC pl Sc B Sg LC LC LC 1.0 IU (OT) 0.25 IU (OT) Control (OT) Figure 2
10
Effect of OXT on Oxytocin receptor mRNA in testis (in vivo)
Control 0.25 IU 1.0 IU 350 bp 1000 900 800 700 600 500 400 300 200 100 mRNA levels Dose of OT (IU/day/BW) 0.25 1.0 - + b c a Oxytocin receptor Forward F(1C) 5'GGACGTCAATGCGCCCAAAGAAG3' Reverse (R8) 5'ACTCGAGCTGCAACGACTCA3' Figure 3
11
Effect of OXT on LH-R and StAR Protein expression in testis (in vivo)
(B) (A) LH-R StAR β- actin β- actin % RIDV Dose of OT (IU/day/BW) 0.25 1.0 - + a b c c % RIDV b Dose of OT (IU/day/BW) 0.25 1.0 - + a Figure 4
12
Effect of OXT on PCNA protein expression in testis (in vivo)
(B) (C) p Sc pl Sc p Sc B Sg L pl Sc L B Sg Control 0.25 IU 1.0 IU c b (D) PCNA % RIDV a β-actin Dose of OT (IU/day/BW) 0.25 1.0 - + Figure 5
13
Effect of OXT on Bcl2 and Androgen receptor protein expression in testis (in vivo)
% RIDV Dose of OT (IU/day/BW) 0.25 1.0 - + a b c (A) Bcl2 β Actin % RIDV Dose of OT (IU/day/BW) 0.25 1.0 - + a b c (B) AR β-actin Figure 6
14
Effect of OXT on GnRH-R protein expression in testis (in vivo)
Dose of OT (IU/day/BW) 0.25 1.0 - + c b GnRH-R β Actin a % RIDV Figure 7
15
Effect of OXT on testosterone level in media and StAR protein expression
in testis (in vitro) (A) Testosteronelevel (ng/mL) b c d - Dose of OT (IU/mL) 10 0.05 Dose of LH (ng/mL) a (B) StAR β-actin b c d % RIDV a Dose of OT (IU/mL) - 10 0.05 Dose of LH (ng/mL) Figure 8
16
Effect of OXT on GnRH-R protein expression in testis (in vitro)
Dose of OT (IU/mL) - 10 0.05 Dose of LH (ng/mL) a b c d % RIDV GnRH-R β-actin Figure 9
17
Conclusion… OXT treatment causes significant changes in the spermatogenic and steroidogenic activity in testis of pre-pubertal mice OXT showed increaased proliferation of germ cell by increased expression of PCNA, AR and Bcl2 protein in testis OXT stimulate testosterone synthesis due to stimulatory effect on 3 β HSD activity and increased expression of StAR and LH-R protein in testis OXT stimulate the GnRH-R protein expression in testis Thus, OXT may act as autocrine/paracrine factor for the testicular activity and locally produced OXT may act throgh autocrine/paracrine mechanism by Leydig cell
18
Histopathological changes
Summary of the study.. Syntocinon/OXT In vitro study In vivo study Pre-pubertal Age ST Leydig cell Histopathological changes LH-R StAR 3βHSD Germ cells in stage VII seminiferous tubules Expression of PCNA protein in spermatogonia Expression of AR expression GnRH-R Detection of anti apoptotic germ cells Testosterone Expression of Bcl2 As a autocrine/paracrine factor and enhanced reproductive activity /Precocious puberty
19
Thank you
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.