1. Hui Wang OARDC E-mail:wang.t3@osu.edu
How to use SSRHunter
Hui Wang
OARDC

2. Purpose of this tutorial
To demonstrate how to download and install SSRHunter software.
Demonstrate use of SSRHunter to identify potential SSRs in a sequence.
To demonstrate how to design a PCR-based molecular marker for a Simple Sequence Repeat (SSR) using SSRhunter.
Hayden, M.J. and P.J. Sharp Nucleic Acids Research 29 (8):e44.
Li, Q., and Wan, J. M.. Yi chuan SSRHunter: development of a local searching software for SSR sites.
Ssr or microsatellites are highly polymorphic and abundant sequences dispersed throughout eukaryotic genomes.
Targeted development of informative microsatellite markers.

3. SSR hunter Software language: Chinese and English
Operating Systems: Win9x/Me/NT/2000/XP/2003
1: even chinese but it is so handy to use, no problem for person without chinese background;
2:it does not work on mac.
3:Next several slides will show us how to get this software.

4. Search for “ssrhunter”
Click this link!!!
That is what I want!!!

5. Download Page
Scroll Down!!!

6. Click here!!!

7. Wait 5 seconds!!!

8. Save or open the program!!!
I recommend you SAVE to the DESKTOP and then unpack.

9. Save to Desktop

10. Download Complete!!!
Click open folder, and Click on the
.exe file

11. 1:Choose options
2:Paste in sequence
3:Click Run

12. This option means the maximum nucleotide repeat unit.
eg:attg
Simply paste the sequences in this box.
The bigger size, the longer processing time.
I have used sequences up to ~200Mb.
This option means the minimum repeat.
eg:attgattgattgattgattg or (attg)5
Click to RUN!!!

13. Output file!!! No.; repeat; # repeats; position
1:scaffold06004: sequence for example
Output file!!!

14. Copy output into a Word or text file.

15. 24. ACA 重复次数： 6
scaffold06004::
99808aatagaggcacataagttacaattaaatagatatcagtacgttctcaataatcgggaaaacaaaatagaagagaaaaaggcaggtgatgaactaagttttcctataaaatagtttatgcttaattttacagctaaaggttgtggaagttgACAACAACAACAACAACAtacctactgtagttccacaagtggggtctgggaatgttaggatgtacacaaaccttaaccctacctttgttgtggaagttgccaaaaaaacaaaaactctatggttgcttggttcagagatatttgaggaccttttctgcaatatcctca
Output contains information for many possible SSR sequences. One example is shown here.

16. What is the next step?
.Primer3 to design your primer according to the SSR hunter output.
(Uniform Resource Locator for Primer3)

17. Select product size (I suggest 150-250)
Simply paste the sequences in this box.
Select product size (I suggest )
Click to pick primers!!!

18. There are the primers!!!

19. What is the last step?
. Run PCR and separate fragments for validation. . In my experience, more than 60% of putative SSRs identified with SSRHunter detect polymorphisms.

20. In this example, 3%agarose 3h detects a polymorphism.
EP1546/EP1565-PI
EP1546/EP1565-OH
EP1546/EP1565-H
EP1566/EP1567-PI
EP1566/EP1567-OH
EP1566/EP1567-H
EP1568/EP1569-PI
EP1568/EP1569-OH
EP1568/EP1569-H
EP1548/EP1549-PI
EP1548/EP1549-OH
EP1548/EP1549-H
That is what I want!!!

21. Thank you!!!