Download presentation
Presentation is loading. Please wait.
1
Ecclesiastes 3:1 1 To every thing there is a season, and a time to every purpose under the heaven:
2
Initiation of Transcription
Timothy G. Standish, Ph. D.
3
All Genes Can’t be Expressed At The Same Time
Some gene products are needed by all cells all the time. These constitutive genes are expressed by all cells. Other genes are only needed by certain cells or at specific times, expression of these inducible genes is tightly controlled in most cells. For example, pancreatic b cells make insulin by expressing the insulin gene. If neurons expressed insulin, problems would result.
4
Operons Are Groups Of Genes Expressed By Prokaryotes
The genes grouped in an operon are all needed to complete a given task Each operon is controlled by a single control sequence in the DNA Because the genes are grouped together, they can be transcribed together then translated together
5
The Lac Operon Genes in the lac operon allow E. coli bacteria to metabolize lactose Lactose is a sugar that E. coli is unlikely to encounter. Production of lactose metabolizing enzymes when not needed would be wasteful Metabolizing lactose for energy only makes sense when two criteria are met: Other more readily metabolized sugar (glucose) is unavailable Lactose is available
6
The Lac Operon - Parts The lac operon is made up of a control region and four genes The four genes are: LacZ - b-galactosidase - Hydrolizes the bond between galactose and glucose LacY - Codes for a permease that lets lactose across the cell membrane LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain Repressor - A protien that works with the control region to control expression of the operon
7
The Lac Operon - Control
The control region is made up of two parts: Promoter These are specific DNA sequences to which RNA Polymerase binds so that transcription can occur The lac operon promoter also has a binding site for another protein called CAP Operator The binding site of the repressor protein The operator is located down stream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe
8
The Lac Operon: When Glucose Is Present But Not Lactose
Come on, let me through Repressor mRNA Hey man, I’m constitutive RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding Repressor No way Jose! Repressor CAP
9
The Lac Operon: When Glucose And Lactose Are Present
Great, I can transcribe! Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding X Repressor Repressor Lac This lactose has bent me out of shape Repressor CAP Some transcription occurs, but at a slow rate
10
The Lac Operon: When Lactose Is Present But Not Glucose
Bind to me Polymerase Yipee…! Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding CAP cAMP X Repressor Repressor CAP cAMP Lac Repressor This lactose has bent me out of shape CAP cAMP
11
The Lac Operon: When Neither Lactose Nor Glucose Is Present
Alright, I’m off to the races . . . Bind to me Polymerase Repressor mRNA Hey man, I’m constitutive Come on, let me through! RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding CAP cAMP STOP Right there Polymerase CAP cAMP CAP cAMP
12
The Trp Operon Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan Enzymes encoded by genes in the trp operon are all involved in the biochemical pathway that converts the precursor chorismate to tryptophan. The trp operon is controlled in two ways: Using a repressor that works in exactly the opposite way from the lac operon repressor Using a special attenuator sequence
13
The Tryptophan Biochemical Pathway
COO- H CH2 C HO O Chorismate O -OOC OH HN H -2O3P CH2 5-Phosphoribosyl- a-Pyrophosphate PPi N-(5’- Phosphoribosyl) -anthranilate Antrhanilate COO- NH2 Glutamate + Pyruvate Glutamine Anthranilate synthetase (trpE and D) N-(5’-Phosphoribosyl)-anthranilate isomerase Indole-3’-glycerol phosphate synthetase (trpC) Tryptophan synthetase (trpB and A) N-(5’-Phosphoribosyl)- Anthranilate isomerase Indole- 3’-glycerol phosphate synthetase -OOC OH -2O3PO CH2 N H C Enol-1-o- Carboxyphenylamino -1-deoxyribulose phosphate CO2+H2O -2O3PO CH2 C H OH N Indole-3-glycerol phosphate Glyceraldehyde- 3-phosphate N H Indole N H -OOC CH2 NH3+ C Tryptophan H2O Serine
14
The Trp Operon: When Tryptophan Is Present
Repressor mRNA Hey man, I’m constitutive Foiled Again! RNA Pol. Repressor Promo. trpD trpB Lead. Operator trpA trpC trpE Aten. Trp Repressor STOP Right there Polymerase Repressor Trp
15
The Trp Operon: When Tryptophan Is Absent
Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor Promo. trpD trpB Lead. Operator trpA trpC trpE Aten. Repressor needs his little buddy tryptophan if I’m to be stopped Repressor I need tryptophan
16
Attenuation The trp operon is controlled both by a repressor and attenuation Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes
17
Transcription And Translation In Prokaryotes
3’ 5’ 5’ mRNA RNA Pol. Ribosome Ribosome
18
The Trp Leader and Attenuator
Met-Lys-Ala-Ile-Phe-Val- AAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU-UUC-GUA- Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA-AACGGGCAGUGUAUU CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGAGCGGGCUUUU Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA-AAA-CCG trpE . . . Terminator 4 1 2 3
19
The mRNA Sequence Can Fold In Two Ways
4 1 2 3 4 1 2 3 Terminator haripin
20
The Attenuator When Starved For Tryptophan
3’ 5’ Ribosome RNA Pol. Help, I need Tryptophan 4 1 2 3
21
The Attenuator When Tryptophan Is Present
3’ 5’ 4 1 2 3 Ribosome RNA Pol. RNA Pol.
22
Expression Control In Eukaryotes
Some of the general methods used to control expression in prokaryotes are used in eukaryotes, but nothing resembling operons is known Eukaryotic genes are controlled individually and each gene has specific control sequences preceding the transcription start site In addition to controlling transcription, there are additional ways in which expression can be controlled in eukaryotes
23
Eukaryotes Have Large Complex Geneomes
The human genome is about 3 x 109 base pairs or ≈ 1 m of DNA Because humans are diploid, each nucleus contains 6 x 109 base pairs or ≈ 2 m of DNA Some gene families are located close to one another on the same chromosome Genes with related functions appear to be distributed almost at random throughout the the genome
24
Highly Packaged DNA Cannot be Expressed
Because of its size, eukaryotic DNA must be packaged Heterochromatin, the most highly packaged form of DNA, cannot be transcribed, therefore expression of genes is prevented Chromosome puffs on some insect chomosomes illustrate areas of active gene expression
25
Only a Subset of Genes is Expressed at any Given Time
It takes lots of energy to express genes Thus it would be wasteful to express all genes all the time By differential expression of genes, cells can respond to changes in the environment Differential expression, allows cells to specialize in multicelled organisms. Differential expression also allows organisms to develop over time.
26
Control of Gene Expression
DNA Cytoplasm Nucleus Nuclear pores Packaging Degradation RNA Transcription Modification Ribosome Translation Transportation G AAAAAA RNA Processing mRNA Degradation etc. G AAAAAA G AAAAAA Export
27
Logical Expression Control Points
DNA packaging Transcription RNA processing mRNA Export mRNA masking/unmasking and/or modification mRNA degradation Translation Protein modification Protein transport Protein degradation Increasing cost The logical place to control expression is before the gene is transcribed
28
Three Eukaryotic RNA Polymerases
RNA Polymerase I - Produces rRNA in the nucleolus, accounts for % of transcription RNA Polymerase II - Produces mRNA in the nucleoplasm % of transcription RNA Polymerase III - Produces tRNA in the nucleoplasm - 10 % of transcription
29
A “Simple” Eukaryotic Gene
Transcription Start Site 5’ Untranslated Region 3’ Untranslated Region Introns 3’ 5’ Exon 2 Exon 3 Int. 2 Exon 1 Int. 1 Promoter/ Control Region Exons Terminator Sequence RNA Transcript
30
Enhancers 5’ 3’ 3’ 5’ TF TF 3’ 5’ TF DNA Many bases Enhancer Promoter
Transcribed Region TF 3’ 5’ TF TF 3’ 5’ TF RNA Pol. 5’ RNA Pol.
31
Eukaryotic RNA Polymerase II
RNA polymerase is a very fancy enzyme that does many tasks in conjunction with other proteins RNA polymerase II is a protein complex of over 500 kD with more than 10 subunits:
32
Eukaryotic RNA Polymerase II Promoters
Several sequence elements spread over about 200 bp upstream from the transcription start site make up RNA Pol II promoters Enhancers, in addition to promoters, influence the expression of genes Eukaryotic expression control involves many more factors than control in prokaryotes This allows much finer control of gene expression
33
Initiation T. F. Promoter RNA Pol. II T. F. T. F. RNA Pol. II 5’ mRNA
34
Exon 1 5’ Eukaryotic Promoters Promoter
TATA Sequence elements SSTATAAAASSSSSNNNNNNNNNNNNNNNNNYYCAYYYYYNN S = C or G Y = C or T N = A, T, G or C ~200 bp Transcription start site “TATA Box” Initiator (Template strand) -1+1 ~-25
35
Initiation TFIID Binding
TBP Associated Factors (TAFs) Transcription start site “TATA Box” -1+1 TATA Binding Protein (TBP)
36
Initiation TFIID Binding
Transcription start site TFIID 80o Bend -1+1
37
Initiation TFIIA and B Binding
Transcription start site TFIID TFIIB -1+1 TFIIA
38
Initiation TFIIF and RNA Polymerase Binding
Transcription start site TFIID TFIIB -1+1 TFIIA TFIIF RNA Polymerase
39
Initiation TFIIE Binding
Transcription start site TFIIE TFIID TFIIF RNA Polymerase TFIIB -1+1 TFIIA TFIIE has some helicase activity and may by involved in unwinding DNA so that transcription can start
40
Initiation TFIIH and TFIIJ Binding
Transcription start site TFIIE TFIID TFIIH TFIIF RNA Polymerase TFIIB P -1+1 TFIIA TFIIH has some helicase activity and may by involved in unwinding DNA so that transcription can start
41
Initiation TFIIH and TFIIJ Binding
Transcription start site TFIIE TFIID TFIIH TFIIF RNA Polymerase TFIIB P -1+1 TFIIA
42
Initiation TFIIH and TFIIJ Binding
Transcription start site RNA Polymerase P -1+1
43
The End
Similar presentations
