Download presentation
Presentation is loading. Please wait.
Published byΟνήσιμος Σπυρόπουλος Modified over 6 years ago
1
Databases BI420 – Introduction to Bioinformatics Gabor T. Marth
Department of Biology, Boston College
2
SNP Mining in BAC Overlaps
Human Chromosome Tiling path of BACs (finished or 5x shotgun) Clone overlap GATCGGATCTACTCTTCAAAGAGT GATCGGATCTGCTCTTCAAAGAGT Candidate SNP SNP Marker Map 100 kb
3
BAC overlap mining overlap detection
SNP analysis overlap detection inter- & intra-chromosomal duplications known human repeats fragmentary nature of draft data candidate SNP predictions
4
Title NH0260K08 NH0407F02 Section of base-wise alignment with marked-up candidate SNP (alignment displayed with the CONSED sequence viewer) SNP mark-up tag produced by PolyBayes
5
BAC overlap mining results
~ 30,000 clones >CloneX ACGTTGCAACGT GTCAATGCTGCA >CloneY ACGTTGCAACGT GTCAATGCTGCA 25,901 clones (7,122 finished, 18,779 draft with basequality values) 21,020 clone overlaps (124,356 fragment overlaps) ACCTAGGAGACTGAACTTACTG 507,152 high-quality candidate SNPs (validation rate 83-96%) Marth et al., Nature Genetics 2001 ACCTAGGAGACCGAACTTACTG
6
Database schema C SNP (1) T Clone (1) NH0260K08 Clone (2) NH0407F02
id name received masked 1 NH0260K 2 NH0407F Hit (1) HSP (1) HSP id sense 1 1 Clone (2) NH0407F02 Hit (2) ALLELE id hitID nucleotide 1 1 C 2 2 T HIT id cloneID hspID start end C Hit (1) Allele (1) SNP (1) SNP id submitted Database tables: CLONE table: Clone attributes and sequence file location HSP table: Significant pair-wise BLAST similarity HIT table: Region of a clone that is part of an HSP SNP table: Candidate SNP attributes ALLELE table: Attributes of an allele within a SNP T Hit (2) Allele (2)
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.