2. When you hear “DNA”, what are some thoughts that come to your mind?
Do Now
When you hear “DNA”, what are some thoughts that come to your mind?

3. Where is DNA found?
What organelle is known as the “control center” of the cell?
What structures are found in the nucleus?
Chromosome contain segments called _________ that code for traits.
Genes are made up of __________.
Katy
This is just to get you warmed-up and connect what you’ve learned to what we’re going to learn

4. The Structure of DNA DNA = Deoxyribonucleic acid 3 Components of DNA:
Sugar = Deoxyribose
Phosphates
Nitrogenous bases
Christine
Q: Do you remember what the 3 components of DNA are?
Point out each component in the picture

5. DNA Looks Like A Ladder Similar to a ladder:
Sugar + Phosphate = Sides of a Ladder, “Backbone”
Bases = Rungs of a Ladder
Katy

6. The Nitrogenous Bases 2 different categories of bases: Pyrimidines
Purines
Christine
Q: Does anybody know what the 2 different categories of bases are?
Hint: They both start with “P”
There are a few differences between the two which Katy will explain

7. Pyrimidines
Has 1 Ring
Thymine (T)
Cytosine (C)
Katy

8. Purines
Have 2 Rings
Adenine (A)
Guanine (G)
Katy

9. Base Pairing
In order to form the rungs of the ladder, the bases need to be paired
A pyrimidine and a purine are paired together
Cytosine (C) + Guanine (G)
Thymine (T) + Adenine (A)
Hydrogen bonds form between the pairs and hold them together
Christine
The # of C is equal to the # of G
The # of T is equal to the # of A
Possible Q: Is it always equal….mutation

10. Bases: So What?
Different sequences of bases code for different genes/traits.
Each gene has its own unique sequence of letters/bases
Each gene codes for a protein that has its own unique function in a cell.
Katy
Possible Q: I thought each gene coded for a trait, not a protein
Answer: The proteins perform specific functions that produce the traits that we see

11. How can 4 letters (A,T,C,G) code for all of our different genes?
Think of the 26 letters in an alphabet
Letters can be combined in endless different ways to form an endless amount words
In the same way, the 4 bases can be combined in endless different ways to form an endless amount of different sequences, resulting in different genes
Katy

12. Double Helix
The DNA ladder is actually twisted (coiled)!
Christine

13. Double Helix
It looks like a spiral staircase!
Christine

14. Why Do You Think DNA Is Coiled?
Christine

15. Double Helix Double helix consists of 2 strands
Each strand consists of…
a sugar-phosphate backbone + a sequence of nitrogenous bases
The two strands complement each other
Katy
You’ll see that the G pairs with the C and that A pairs with T
Now, we’ll do an activity where we can practice this, but first we’ll watch a video

16. Practice Write the sequence that complements the following strand:
AATCGGGTACGTAGGTCGTAGCT
Christine
Write down the strand on the board as they work on it

17. Why do you think a purine is paired with a pyrimidine?
Base Pairing
Why do you think a purine is paired with a pyrimidine?

18. Answer
The difference in the number of rings of purines & pyrimidines is important
If 2 purines (which each has 2 rings) paired together, it would be too wide to fit within the backbone
If 2 pyrimidines (which each has 1 ring) paired together, it would be too narrow to fit within the backbone

19. Hands-On Activity:
Building a model of DNA