Download presentation
Presentation is loading. Please wait.
1
mRNA attaches to a Ribosome
Translation Step 1 mRNA attaches to a Ribosome Ribosome UGUGCUGUCUUGUCUGAUGGGCUACCUAUAA mRNA
2
Translation Step 2 Every group of three RNA nitrogen bases is called a codon. The ribosome finds and begins at the “start codon” AUG. Ribosome Start Codon Codon UGUGCUGUCUUGUCUGAUGGGCUACCUAUAA mRNA 2
3
Translation Step 3 Transfer RNA’s (tRNA) bring amino acids to the Ribosome. Each tRNA has an “anticodon” that matches to a codon on mRNA. Amino Acid Met Ribosome tRNA Anticodon Codon UAC UGUGCUGUCUUGUCUGAUGGGCUACCUAUAA mRNA 3
4
Translation Step 4 As more tRNA’s bring amino acids they bind together to form a polypeptide. Polypeptide Met Gly Tyr Ribosome tRNA tRNA tRNA UAC CCG AUG UGUGCUGUCUUGUCUGAUGGGCUACCUAUAA mRNA 4
5
Translation Step 5 The Ribosome moves down the mRNA adding amino acids to the polypeptide until it reaches the “stop codon”, the ribosome then releases the polypeptide. Met Tyr Lys Gly Polypeptide tRNA tRNA AUG GAU Stop Codon UGUGCUGUCUUGUCUGAUGGGCUACCUAUAA mRNA 5
6
Translation So What?? The importance of translation is that it makes sure the sequence of amino acids used to assemble a protein is perfect. *If just one amino acid is missing or out of order then the protein could not work at all or function in a way that damages the cell. 6
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.