Download presentation
Presentation is loading. Please wait.
Published byMadeline Cunningham Modified over 6 years ago
1
April 21, 2011 Why is DNA double stranded?
If I compared the DNA of a human to that of a whale, what similarities would they have? Differences? *** Bring up the handout from the BOOK (“Study Guide”); make sure your name is on it!
2
Mutations What are they? Can be Changes in DNA or RNA Sequence
Beneficial Sickle Cell Anemia carriers are less likely to contract malaria Ability to digest lactose Neutral Harmful Genetic disorders
3
Mutations Can only be passed to future generations if they occur in a sex cell Aka gamete Sperm/egg
4
Types of Mutations: Least Harmful
Point mutations Change in one base only Results in one amino acid change, early stop of translation, or no change at all Three types Silent Missense Nonsense
5
Types of Mutations: Least Harmful
Silent mutation One base changes, no change in amino acid Original DNA: ATACGGCATGGGCACTAGG Original mRNA: UAUGCCGUACCCGUGAUCC Original AA: M, P, Y, P, Stop Mutated DNA: ATACGGCATGGGGACTAGG Mutated mRNA: UAUGCCGUACCCCUGAUCC Mutated AA: M, P, Y, P, Stop
6
Types of Mutations: Least Harmful
Missense mutation One base changes and one amino acid changes Original DNA: ATACGGCATGGGCACTAGG Original mRNA: UAUGCCGUACCCGUGAUCC Original AA: M, P, Y, P, Stop Mutated DNA: ATACGGCAGGGGCACTAGG Mutated mRNA: UAUGCCGUCCCCGUGAUCC Mutated mRNA: M, P, S, P, stop
7
Epidermolysis bullosa
Sickle Cell Anemia Some forms of Cystic Fibrosis (respiratory) & ALS (Lou Gehrig’s Disease, nervous system & muscles) Epidermolysis bullosa
8
Types of Mutations: Least Harmful
Nonsense mutation One base changes, results in early stop (short protein) Original DNA: ATACGGCATGGGCACTAGG Original mRNA: UAUGCCGUACCCGUGAUCC Original AA: M, P, Y, P, Stop Mutated DNA: ATACGGCATCGGCACTAGG Mutated mRNA: UAUGCCGUAGCCGUGAUCC Mutated mRNA: M, P, stop
9
Duchenne Muscular Dystrophy
Hurler Syndrome (disorder associated with lysosomes)
10
Types of Mutations: Next Harmful
Frameshift mutation Base is added in or deleted, shifting the reading frame Many amino acids change, could end protein early or make it extra long Original DNA: ATACGGCATGGGCACTAGG Original mRNA: UAUGCCGUACCCGUGAUCC Original AA: M, P, Y, P, Stop Mutated DNA: ATACGGCATGTGGCACTAGG Mutated mRNA: UAUGCCGUACACCGUGAUCC Mutated AA: M, P, Y, T, V, I
11
Tay Sachs Disease
12
Types of Mutations: Most Harmful
Chromosomal Large sections of DNA are flipped around, duplicated/copied, removed, etc
13
Charcot Marie Tooth Disease
Jacobsen Disorder
14
Causes of Mutations Spontaneous (Random chance) Mutagens
During DNA replication (copying) when cells divide During transcription (DNA mRNA) Mutagens External things that increase likelihood of mutations occurring Radiation Chemicals (benzene, cyanide, asbestos, etc)
15
Repairing DNA Enzymes proofread DNA and RNA
If enzymes are exposed to mutagens, they are likely to mutate and then won’t do their job correctly.
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.