Presentation is loading. Please wait.

Presentation is loading. Please wait.

from nucleic acid language to amino acid language

Similar presentations


Presentation on theme: "from nucleic acid language to amino acid language"— Presentation transcript:

1 from nucleic acid language to amino acid language
Translation from nucleic acid language to amino acid language

2 How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

3 mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

4 WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT
1960 | 1968 Cracking the code Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT Codon = 3 bases of mRNA

5 The code Code for ALL life! Start codon Stop codons
strongest support for a common origin for all life several codons for each amino acid Start codon AUG methionine Stop codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.

6 How are the codons matched to amino acids?
3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

7 DNA mRNA protein trait From gene to protein nucleus cytoplasm
aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

8 Transfer RNA structure
“Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

9 Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon
organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

10 Building a polypeptide
1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

11 Can you tell the story? See if you get it! RNA polymerase DNA
amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

12 Video demonstration


Download ppt "from nucleic acid language to amino acid language"

Similar presentations


Ads by Google