Download presentation
Presentation is loading. Please wait.
1
Isaiah 33:22 22 For the Lord is our judge, the Lord is our lawgiver, the Lord is our king; he will save us.
2
Replication and Recombination
Timothy G. Standish, Ph. D.
3
The Information Catch 22 With only poor copying fidelity, a primitive system could carry little genetic information without L [the mutation rate] becoming unbearably large, and how a primitive system could then improve its fidelity and also evolve into a sexual system with crossover beggars the imagination." Hoyle F., "Mathematics of Evolution", [1987], Acorn Enterprises: Memphis TN, 1999, p20
4
DNA Replication: How We Know
There are three ways in which DNA could be replicated: Old Conservative - Old double stranded DNA serves as a template for two new strands which then join together, giving two old strands together and two new strands together Old Semi-conservative - Old strands serve as templates for new strands resulting in double stranded DNA made of both old and new strands + Old New + New Old + Old + New + Old + New or Old Dispersive - In which sections of the old strands are dispersed in the new strands
5
The Meselson-Stahl Experiment
The Meselson-Stahl experiment demonstrated that replication is semiconservative This experiment took advantage of the fact that nucleotide bases contain nitrogen Thus DNA contains nitrogen OH H P O HO NH2 N The most common form of Nitrogen is N14 with 7 protons and 7 neutrons N15 is called “heavy nitrogen” as it has 8 neutrons thus increasing its mass by 1 atomic mass unit
6
The Meselson-Stahl Experiment
Transfer to normal N14 media Bacteria grown in N15 media for several replications After 20 min. (1 replication) transfer DNA to centrifuge tube and centrifuge Semi-conservative model prediction Conservative model prediction Dispersive model prediction X The conservative and dispersive models make predictions that do not come true thus, buy deduction, the semi-conservative model must be true. Prediction after 2 or more replications X X
7
Stages of Replication Replication can be divided into three stages:
Initiation - When DNA is initially split into two strands and polymerization of new DNA is started Elongation - When DNA is polymerized Termination - When the new strands of DNA are completed and some finishing touches may be put on the DNA Both elongation and termination may involve proof reading of the DNA ensuring that mutations are not incorporated into newly formed DNA strands
8
Tools of Replication Enzymes are the tools of replication:
DNA Polymerase - Matches the correct nucleotides then joins adjacent nucleotides to each other Primase - Provides an RNA primer to start polymerization Ligase - Joins adjacent DNA strands together (fixes “nicks”)
9
More Tools of Replication
Helicase - Unwinds the DNA and melts it Single Strand Binding Proteins - Keep the DNA single stranded after it has been melted by helicase Gyrase - A topisomerase that Relieves torsional strain in the DNA molecule Telomerase - Finishes off the ends of DNA strands
10
Initiation Initiation starts at specific DNA sequences called origins (Ori C = origin in E. coli chromosomes) Long linear chromosomes have many origins First the origin melts (splits into two single strands of DNA) Next primers are added Finally DNA polymerase recognizes the primers and starts to polymerize DNA 5’ to 3’ away from the primers
11
Initiation - Forming the Replication Eye Or Bubble
Origin of Replication 5’ 3’ Replication eye or replication bubble 5’ 3’ 3’ 5’ 5’ 3’
12
Large Linear Chromosomes Have Many Origins Of Replication
3’ 5’ 5’ 3’ 5’ 3’ 3’ 5’
13
Extension - The Replication Fork
5’ 3’ Primase - Makes RNA primers Single strand binding proteins - Prevent DNA from re-anealing Laging Strand 3’ 5’ 5’ 3’ Okazaki fragment RNA Primers DNA Polymerase Helicase - Melts DNA Leading Strand 5’
14
Extension - Okazaki Fragments
DNA Pol. 3’ 5’ RNA Primer Okazaki Fragment DNA Polymerase has 5’ to 3’ exonuclease activity. When it sees an RNA/DNA hybrid, it chops out the RNA and some DNA in the 5’ to 3’ direction. 3’ 5’ RNA Primer DNA Pol. RNA and DNA Fragments DNA Polymerase falls off leaving a nick. 3’ 5’ RNA Primer Ligase Nick The nick is removed when DNA ligase joins (ligates) the DNA fragments.
15
The Role of DNA Gyrase Helicase
16
The Role of DNA Gyrase Helicase Supercoiled DNA Gyrase
17
The Role of DNA Gyrase Gyrase
18
The Role of DNA Gyrase Gyrase
19
The Role of DNA Gyrase Gyrase
20
The Role of DNA Gyrase Gyrase
21
The Role of DNA Gyrase Gyrase
22
The Role of DNA Gyrase Gyrase
23
The Role of DNA Gyrase Gyrase
24
The Role of DNA Gyrase Gyrase
25
The Role of DNA Gyrase Gyrase
26
E. coli DNA Polymerases E. coli has three identified DNA polymerases each of which has significantly different physical characteristics and roles in the cell II III I Polymerase Yes 5’- 3’ Polymerization Yes 3’-5’ Exonuclease Yes No 5’-3’ Exonulcease 400 ? 15 Molecules/cell Major function Proofreading/ Removal of RNA primers Repair of damaged DNA Replication polymerization 10 subunits 600,000 daltons
27
Mutation When Mistakes Are Made
5’ DNA Pol. 5’ 3’ Mismatch 5’ DNA Pol. 5’ 3’ 3’ to 5’ Exonuclease activity DNA Pol. 5’ 3’
28
Mutation Excision Repair
3’ 5’ Endo- Nuclease Thimine Dimer 5’ 3’
29
Mutation Excision Repair
3’ 5’ Endo- Nuclease 5’ 3’ Nicks DNA Pol. 5’ 3’
30
Mutation Excision Repair
3’ 5’ Endo- Nuclease 5’ 3’ DNA Pol. 5’ 3’
31
Mutation Excision Repair
3’ 5’ Endo- Nuclease 5’ 3’ Nicks 5’ 3’ Ligase Ligase Nick DNA Pol.
32
Telomerase At the end of linear chromosomes the lagging strand can’t be completed as the last primer is removed and no 3’ hydroxyl group is available for DNA polymerase to extend from Telomere 3’ 5’ 3’ 5’ Degradation of RNA primer at the 5’ end 3’ 5’ Next replication 3’ 5’ +
33
Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length AACCCCAAC Telomerase RNA 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG GGGTTG
34
Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length AACCCCAAC Telomerase RNA 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG GGGTTG GGGTTG
35
Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length AACCCCAAC Telomerase RNA 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG GGGTTG GGGTTG GGGTTG
36
Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGGGTTGGGGTTGGGGTTG 3’CTGGCTCGG O N H Guanine O N H Guanine
37
Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing DNA Pol. 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG GGGGTTG T 3’CTGGCTCGG 3’GTTGGGG T
38
Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing DNA Pol. Endo- nuclease 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG T 3’CTGGCTCGG AGAACCCAACCCGTTGGGG T
39
Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGG 3’CTGGCTCGG AGAACCCAACCC GTTGGGG T Endo- nuclease
40
The Current Eukaryotic Recombination Model
Homologous chromosomes Meiosis Prophase I
41
The Current Eukaryotic Recombination Model
Exo- nuclease Double strand break
42
The Current Eukaryotic Recombination Model
Exo- nuclease
43
The Current Eukaryotic Recombination Model
Exo- nuclease
44
The Current Eukaryotic Recombination Model
Exo- nuclease
45
The Current Eukaryotic Recombination Model
DNA Polymerase
46
The Current Eukaryotic Recombination Model
DNA Polymerase
47
The Current Eukaryotic Recombination Model
DNA Polymerase
48
The Current Eukaryotic Recombination Model
DNA Polymerase
49
The Current Eukaryotic Recombination Model
50
Holliday Structure
51
Holliday Structure Bend
52
Holliday Structure Bend Twist
53
Holliday Structure Cut
54
Holliday Structure Cut
55
Holliday Structure Cut
56
Holliday Structure Cut
57
Holliday Structure
58
Cutting The Holliday Structure
59
The End
Similar presentations
